Mutagenetix > Incidental Mutation

Incidental Mutation 'R6045:Rfc1'

483761

Institutional Source

Beutler Lab

Gene Symbol

Rfc1

Ensembl Gene

ENSMUSG00000029191

Gene Name

replication factor C (activator 1) 1

Synonyms

140kDa, Recc1, Alp145, RFC140

MMRRC Submission

044213-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6045 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

65261850-65335670 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 65279549 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 596 (I596T)

Ref Sequence

ENSEMBL: ENSMUSP00000145385 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172732] [ENSMUST00000203471] [ENSMUST00000203581] [ENSMUST00000204965]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000172732
AA Change: I582T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000134444
Gene: ENSMUSG00000029191
AA Change: I582T

Domain	Start	End	E-Value	Type
low complexity region	31	44	N/A	INTRINSIC
low complexity region	79	93	N/A	INTRINSIC
low complexity region	139	152	N/A	INTRINSIC
low complexity region	308	325	N/A	INTRINSIC
low complexity region	342	360	N/A	INTRINSIC
BRCT	401	479	7.39e-17	SMART
low complexity region	484	502	N/A	INTRINSIC
AAA	627	762	9.65e-10	SMART
Pfam:RFC1	899	1052	5.2e-62	PFAM
low complexity region	1104	1132	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000203471
AA Change: I582T

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000144954
Gene: ENSMUSG00000029191
AA Change: I582T

Domain	Start	End	E-Value	Type
low complexity region	31	44	N/A	INTRINSIC
low complexity region	79	93	N/A	INTRINSIC
low complexity region	139	152	N/A	INTRINSIC
low complexity region	308	325	N/A	INTRINSIC
low complexity region	342	360	N/A	INTRINSIC
BRCT	401	479	7.39e-17	SMART
low complexity region	484	502	N/A	INTRINSIC
AAA	627	762	9.65e-10	SMART
Pfam:RFC1	899	1052	2.5e-61	PFAM
low complexity region	1104	1132	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000203581
AA Change: I596T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000145385
Gene: ENSMUSG00000029191
AA Change: I596T

Domain	Start	End	E-Value	Type
low complexity region	31	44	N/A	INTRINSIC
low complexity region	79	93	N/A	INTRINSIC
low complexity region	139	152	N/A	INTRINSIC
low complexity region	322	339	N/A	INTRINSIC
low complexity region	356	374	N/A	INTRINSIC
BRCT	415	493	7.39e-17	SMART
low complexity region	498	516	N/A	INTRINSIC
AAA	640	775	9.65e-10	SMART
Pfam:RFC1	912	1065	2.6e-61	PFAM
low complexity region	1117	1145	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000204965
AA Change: I582T

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000144980
Gene: ENSMUSG00000029191
AA Change: I582T

Domain	Start	End	E-Value	Type
low complexity region	31	44	N/A	INTRINSIC
low complexity region	79	93	N/A	INTRINSIC
low complexity region	139	152	N/A	INTRINSIC
low complexity region	308	325	N/A	INTRINSIC
low complexity region	342	360	N/A	INTRINSIC
BRCT	401	479	7.39e-17	SMART
low complexity region	484	502	N/A	INTRINSIC
AAA	627	762	9.65e-10	SMART
Pfam:RFC1	899	1052	2.5e-61	PFAM
low complexity region	1104	1131	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the large subunit of replication factor C, a five subunit DNA polymerase accessory protein, which is a DNA-dependent ATPase required for eukaryotic DNA replication and repair. The large subunit acts as an activator of DNA polymerases, binds to the 3' end of primers, and promotes coordinated synthesis of both strands. It may also have a role in telomere stability. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Mar 2011]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700011L22Rik	T	C	8: 79,229,367	Y87C	probably benign	Het
5530401A14Rik	A	G	11: 81,893,868		probably benign	Het
5830473C10Rik	A	T	5: 90,584,989	Q553L	possibly damaging	Het
Adamts5	T	C	16: 85,899,300	D323G	probably damaging	Het
Bicc1	G	A	10: 70,957,081	R248*	probably null	Het
Bivm	T	G	1: 44,119,073		probably benign	Het
Ccdc8	A	C	7: 16,996,031	T482P	unknown	Het
Ccnb2	T	C	9: 70,419,093	I21V	probably benign	Het
Cfap73	A	T	5: 120,631,712	I82N	probably damaging	Het
Chd3	A	C	11: 69,352,118	F1426V	possibly damaging	Het
Clcn2	A	T	16: 20,711,688		probably null	Het
Col6a5	T	C	9: 105,925,918	N1283D	unknown	Het
Cyp39a1	G	T	17: 43,731,991	G411W	probably damaging	Het
D130052B06Rik	A	T	11: 33,624,008	I202L	unknown	Het
Dlgap1	T	C	17: 70,818,098	L948P	probably damaging	Het
Dnah3	C	T	7: 119,967,522	V2494M	probably damaging	Het
Dysf	T	A	6: 84,114,072	V1076D	probably damaging	Het
Eif2ak4	C	A	2: 118,388,815	S36*	probably null	Het
Elmod3	C	T	6: 72,568,868	R297H	probably benign	Het
Epas1	C	A	17: 86,809,399	R166S	probably damaging	Het
Erv3	A	G	2: 131,856,022	L139P	probably damaging	Het
Fryl	A	G	5: 73,118,551	V90A	probably damaging	Het
Fxr2	A	G	11: 69,651,051	R439G	possibly damaging	Het
Gabrd	A	T	4: 155,386,474	V259D	possibly damaging	Het
Galnt10	A	G	11: 57,783,793	Y536C	probably damaging	Het
Gbp10	A	T	5: 105,218,403	L545Q	probably damaging	Het
Gfpt1	A	T	6: 87,085,257	I517F	probably damaging	Het
Glb1	T	C	9: 114,437,942	Y225H	probably damaging	Het
Gm1110	C	T	9: 26,883,209		probably null	Het
Gm14851	A	T	8: 21,095,232	C65S	possibly damaging	Het
Gm36028	G	T	16: 37,856,022	Q128K	probably benign	Het
Gmps	C	T	3: 63,980,137	P10L	probably benign	Het
Greb1l	T	A	18: 10,547,068	V1465D	probably damaging	Het
Helz2	A	G	2: 181,240,313	V229A	probably benign	Het
Hipk1	A	T	3: 103,746,902	L924Q	probably benign	Het
Ifngr1	T	G	10: 19,609,161	L303V	possibly damaging	Het
Kif22	T	C	7: 127,031,078	N429D	probably benign	Het
Ktn1	T	C	14: 47,676,796	Y401H	probably damaging	Het
Lars2	T	G	9: 123,371,988	I39S	probably damaging	Het
Lipf	C	T	19: 33,966,844	A151V	probably damaging	Het
Lrp1	A	T	10: 127,566,600	M2234K	probably damaging	Het
Lrp1b	A	G	2: 40,701,813	V56A	unknown	Het
Lyar	T	A	5: 38,234,008	H350Q	probably benign	Het
Mill2	A	T	7: 18,856,564	M190L	probably benign	Het
Morc3	A	G	16: 93,874,845	D921G	probably damaging	Het
Mpp2	G	T	11: 102,059,354	T558K	probably benign	Het
Myh4	A	G	11: 67,244,724	D379G	probably benign	Het
Neb	A	C	2: 52,194,425		probably null	Het
Nedd1	G	A	10: 92,695,100	R376*	probably null	Het
Nlrc4	T	G	17: 74,446,959	D143A	probably damaging	Het
Nol10	G	T	12: 17,348,478		probably benign	Het
Olfr1316	T	G	2: 112,130,536	I92L	possibly damaging	Het
Olfr1404	C	T	1: 173,216,500	T283I	possibly damaging	Het
Olfr1431	C	A	19: 12,210,295	A243D	probably damaging	Het
Olfr197	T	A	16: 59,186,091	T131S	probably benign	Het
Olfr652	C	T	7: 104,564,767	T182I	probably benign	Het
Opn1sw	A	G	6: 29,379,870	S122P	probably damaging	Het
Orm1	T	A	4: 63,344,692	I32N	possibly damaging	Het
Pcdhb5	T	A	18: 37,321,575	V336E	probably damaging	Het
Poli	C	T	18: 70,517,469	R363K	possibly damaging	Het
Rabgap1l	T	C	1: 160,645,323	E515G	probably benign	Het
Rem2	C	A	14: 54,477,768	T134N	probably damaging	Het
Ruvbl2	A	T	7: 45,425,009	I202N	probably damaging	Het
S100a6	T	A	3: 90,613,879	I38N	probably damaging	Het
Scel	T	C	14: 103,592,213	C435R	probably benign	Het
Slc6a13	T	A	6: 121,321,628	W146R	probably damaging	Het
Sorcs1	T	A	19: 50,190,117	K856*	probably null	Het
Speer4e	T	G	5: 14,937,181	K70T	possibly damaging	Het
Sucla2	T	A	14: 73,568,964	C158*	probably null	Het
Tie1	G	A	4: 118,484,691	S187L	probably benign	Het
Tmem200a	T	C	10: 25,993,007	T455A	probably damaging	Het
Tra2a	A	G	6: 49,252,464		probably benign	Het
Tsnaxip1	A	C	8: 105,844,187	E615A	probably benign	Het
Tuba3b	T	A	6: 145,621,174	N380K	probably damaging	Het
Umod	C	T	7: 119,476,823	S240N	probably benign	Het
Vmn2r92	G	A	17: 18,168,043		probably null	Het
Vps13b	A	G	15: 35,671,316	E1655G	probably damaging	Het
Vwde	A	T	6: 13,219,936	I72N	probably damaging	Het
Wbp11	G	A	6: 136,821,535	A172V	probably damaging	Het
Zbtb41	T	A	1: 139,424,032	N294K	probably benign	Het
Zfhx4	T	A	3: 5,396,959	H1206Q	probably damaging	Het

Other mutations in Rfc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00551:Rfc1	APN	5	65296009	missense	probably benign	0.00
IGL00909:Rfc1	APN	5	65279699	missense	probably benign	0.00
IGL01791:Rfc1	APN	5	65263145	missense	probably benign	0.00
IGL01884:Rfc1	APN	5	65274460	missense	possibly damaging	0.94
IGL02737:Rfc1	APN	5	65311163	missense	possibly damaging	0.82
Disturbing	UTSW	5	65266162	missense	probably damaging	1.00
P0038:Rfc1	UTSW	5	65287961	missense	probably damaging	1.00
R0317:Rfc1	UTSW	5	65296052	splice site	probably null
R0452:Rfc1	UTSW	5	65264297	missense	probably benign	0.01
R0699:Rfc1	UTSW	5	65319399	splice site	probably null
R0945:Rfc1	UTSW	5	65278709	critical splice donor site	probably null
R1192:Rfc1	UTSW	5	65293911	missense	probably benign	0.03
R1341:Rfc1	UTSW	5	65291194	missense	probably damaging	1.00
R1425:Rfc1	UTSW	5	65319518	missense	probably damaging	1.00
R1551:Rfc1	UTSW	5	65277363	missense	probably damaging	0.99
R1800:Rfc1	UTSW	5	65264379	missense	probably damaging	1.00
R1969:Rfc1	UTSW	5	65319524	missense	probably damaging	1.00
R2006:Rfc1	UTSW	5	65311054	nonsense	probably null
R2026:Rfc1	UTSW	5	65288029	missense	probably damaging	1.00
R2073:Rfc1	UTSW	5	65301939	missense	probably damaging	0.98
R2137:Rfc1	UTSW	5	65311039	critical splice donor site	probably null
R2330:Rfc1	UTSW	5	65312969	missense	possibly damaging	0.94
R3774:Rfc1	UTSW	5	65264406	missense	probably damaging	1.00
R3787:Rfc1	UTSW	5	65296014	missense	probably benign	0.00
R4920:Rfc1	UTSW	5	65287928	missense	probably damaging	1.00
R5055:Rfc1	UTSW	5	65266162	missense	probably damaging	1.00
R5308:Rfc1	UTSW	5	65279461	missense	probably damaging	0.99
R5723:Rfc1	UTSW	5	65277426	missense	probably null	0.78
R5729:Rfc1	UTSW	5	65277452	missense	probably damaging	1.00
R5844:Rfc1	UTSW	5	65293787	missense	probably benign	0.19
R6484:Rfc1	UTSW	5	65293677	missense	probably benign	0.01
R6495:Rfc1	UTSW	5	65273815	splice site	probably null
R6531:Rfc1	UTSW	5	65312979	missense	possibly damaging	0.92
R6717:Rfc1	UTSW	5	65302004	nonsense	probably null
R6717:Rfc1	UTSW	5	65312961	missense	probably damaging	0.97
R6845:Rfc1	UTSW	5	65311116	missense	possibly damaging	0.53
R6880:Rfc1	UTSW	5	65277386	missense	probably benign	0.14
R7329:Rfc1	UTSW	5	65263135	missense	unknown
R7331:Rfc1	UTSW	5	65311044	missense	probably damaging	1.00
R7466:Rfc1	UTSW	5	65275426	missense	probably damaging	1.00
R7497:Rfc1	UTSW	5	65279498	missense	probably damaging	1.00
R7588:Rfc1	UTSW	5	65272507	missense	probably damaging	1.00
R8020:Rfc1	UTSW	5	65272178	missense	probably damaging	1.00
R8056:Rfc1	UTSW	5	65294093	intron	probably benign
R8282:Rfc1	UTSW	5	65268946	critical splice donor site	probably null
R8316:Rfc1	UTSW	5	65278734	missense	probably benign	0.05
R8320:Rfc1	UTSW	5	65303036	nonsense	probably null
R8865:Rfc1	UTSW	5	65278792	missense	possibly damaging	0.89
R8968:Rfc1	UTSW	5	65275435	missense	probably benign	0.03
R8997:Rfc1	UTSW	5	65275721	missense	probably damaging	1.00
R9454:Rfc1	UTSW	5	65274431	missense
R9476:Rfc1	UTSW	5	65279799	missense	probably damaging	0.99
R9631:Rfc1	UTSW	5	65272508	missense	probably damaging	1.00
R9758:Rfc1	UTSW	5	65302048	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ATGAACCATGCATGAGCCTTTG -3'
(R):5'- TCCAAATTGGAGCGAACACC -3'

Posted On

2017-07-14