Incidental Mutation 'R0519:Csmd2'
ID 48377
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene Name CUB and Sushi multiple domains 2
Synonyms
MMRRC Submission 038712-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.150) question?
Stock # R0519 (G1)
Quality Score 185
Status Validated
Chromosome 4
Chromosomal Location 127987857-128567656 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 128487005 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Serine at position 2118 (Y2118S)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000184063]
AlphaFold no structure available at present
Predicted Effect
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148247
Predicted Effect possibly damaging
Transcript: ENSMUST00000184063
AA Change: Y2118S

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Meta Mutation Damage Score 0.9617 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A G 5: 107,548,201 (GRCm38) R168G probably benign Het
1700061G19Rik T A 17: 56,885,169 (GRCm38) Y577* probably null Het
2810004N23Rik C T 8: 124,839,929 (GRCm38) G251R possibly damaging Het
3425401B19Rik A G 14: 32,662,962 (GRCm38) S349P possibly damaging Het
Ackr4 A G 9: 104,099,451 (GRCm38) V99A probably benign Het
Asxl3 A G 18: 22,523,520 (GRCm38) Q1529R possibly damaging Het
Atg12 T C 18: 46,741,410 (GRCm38) E46G probably benign Het
Cdcp2 A G 4: 107,107,192 (GRCm38) probably benign Het
Clasrp A G 7: 19,584,164 (GRCm38) probably benign Het
Clip2 A G 5: 134,516,151 (GRCm38) V383A probably benign Het
Cntln C T 4: 85,005,053 (GRCm38) probably benign Het
Colgalt2 G T 1: 152,508,561 (GRCm38) A551S possibly damaging Het
Dip2c T A 13: 9,563,208 (GRCm38) V415E probably damaging Het
Dpy19l2 C T 9: 24,558,095 (GRCm38) R755Q probably benign Het
Dsn1 A T 2: 156,998,713 (GRCm38) probably benign Het
Dtd2 T C 12: 52,004,959 (GRCm38) probably benign Het
Dync1i1 A G 6: 6,027,399 (GRCm38) T602A probably benign Het
Ercc6 A C 14: 32,526,842 (GRCm38) D450A probably damaging Het
Fgf12 A T 16: 28,189,628 (GRCm38) V104D probably benign Het
Frem1 A T 4: 82,970,633 (GRCm38) probably null Het
Gcgr G T 11: 120,536,156 (GRCm38) W88L probably damaging Het
Glb1 ACCC ACC 9: 114,421,744 (GRCm38) probably null Het
Hapln1 A G 13: 89,584,716 (GRCm38) probably benign Het
Hmgn3 T C 9: 83,112,248 (GRCm38) E40G probably damaging Het
Hsdl1 G A 8: 119,565,711 (GRCm38) A255V probably damaging Het
Hyls1 T C 9: 35,561,203 (GRCm38) K306E probably damaging Het
Jcad C T 18: 4,649,122 (GRCm38) probably benign Het
Kif14 C A 1: 136,469,147 (GRCm38) A397E probably damaging Het
Lcmt2 A T 2: 121,139,344 (GRCm38) probably null Het
Lifr T C 15: 7,177,580 (GRCm38) L524P probably damaging Het
Ly6g6f T C 17: 35,082,852 (GRCm38) K209E possibly damaging Het
Macf1 G A 4: 123,471,320 (GRCm38) T1651I probably benign Het
Mapk4 T C 18: 73,970,321 (GRCm38) D39G probably damaging Het
Mbl1 A G 14: 41,158,565 (GRCm38) M137V probably damaging Het
Mcm10 G A 2: 5,008,545 (GRCm38) S92L probably benign Het
Mug1 A G 6: 121,851,424 (GRCm38) K265R possibly damaging Het
Mxra7 A G 11: 116,810,786 (GRCm38) probably null Het
Neu3 G A 7: 99,823,317 (GRCm38) probably benign Het
Nsd1 A G 13: 55,312,835 (GRCm38) T2395A probably benign Het
Olfr1034 A T 2: 86,047,067 (GRCm38) Y195F probably benign Het
Olfr3 T A 2: 36,812,615 (GRCm38) H159L probably damaging Het
Olfr750 T A 14: 51,071,157 (GRCm38) I79F probably damaging Het
Olfr854 A T 9: 19,566,949 (GRCm38) I145N probably benign Het
Osgepl1 T C 1: 53,321,096 (GRCm38) V327A probably damaging Het
Pcdhb21 T C 18: 37,516,032 (GRCm38) V738A possibly damaging Het
Plekha8 A T 6: 54,622,107 (GRCm38) probably benign Het
Ptprq A C 10: 107,538,920 (GRCm38) probably benign Het
Pus10 T A 11: 23,711,201 (GRCm38) F263Y probably benign Het
Rad54b A T 4: 11,599,809 (GRCm38) I338F probably damaging Het
Rad54l2 A G 9: 106,708,299 (GRCm38) F756L probably damaging Het
Scn11a A G 9: 119,790,119 (GRCm38) L719P probably damaging Het
Slc2a2 G A 3: 28,718,816 (GRCm38) V253I possibly damaging Het
Slc39a4 A T 15: 76,615,138 (GRCm38) N192K probably benign Het
Soat1 T A 1: 156,441,246 (GRCm38) I245F probably damaging Het
Sorcs2 G A 5: 36,031,190 (GRCm38) A858V probably benign Het
Tcim T C 8: 24,438,635 (GRCm38) T88A possibly damaging Het
Tecta G A 9: 42,347,892 (GRCm38) probably benign Het
Tgm5 C A 2: 121,048,895 (GRCm38) L553F probably damaging Het
Tjp1 A G 7: 65,302,921 (GRCm38) V1555A probably benign Het
Tmem214 A C 5: 30,869,668 (GRCm38) M1L probably null Het
Togaram1 T C 12: 64,966,002 (GRCm38) probably benign Het
Topaz1 C A 9: 122,749,479 (GRCm38) L485I possibly damaging Het
Ttn T C 2: 76,718,282 (GRCm38) probably benign Het
Ube2o A G 11: 116,546,459 (GRCm38) probably null Het
Ubr7 T A 12: 102,768,206 (GRCm38) D246E probably benign Het
Vcpkmt T C 12: 69,582,328 (GRCm38) D132G probably benign Het
Vmn2r111 T A 17: 22,573,121 (GRCm38) Q51H probably benign Het
Vmn2r95 C T 17: 18,439,503 (GRCm38) P170S probably damaging Het
Zbtb38 A G 9: 96,685,773 (GRCm38) I1086T probably damaging Het
Zfp444 G A 7: 6,188,173 (GRCm38) A118T probably benign Het
Zp2 A G 7: 120,138,149 (GRCm38) I272T probably damaging Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128,483,473 (GRCm38) missense probably benign 0.03
IGL01098:Csmd2 APN 4 128,059,052 (GRCm38) missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128,369,130 (GRCm38) missense probably benign 0.04
IGL01364:Csmd2 APN 4 128,414,288 (GRCm38) missense probably benign 0.01
IGL01530:Csmd2 APN 4 128,414,301 (GRCm38) missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128,563,305 (GRCm38) nonsense probably null
IGL01670:Csmd2 APN 4 128,513,371 (GRCm38) splice site probably benign
IGL01707:Csmd2 APN 4 128,383,005 (GRCm38) missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128,480,845 (GRCm38) splice site probably benign
IGL01837:Csmd2 APN 4 128,419,570 (GRCm38) missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128,559,947 (GRCm38) missense unknown
IGL02013:Csmd2 APN 4 128,321,323 (GRCm38) missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128,559,879 (GRCm38) missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128,477,470 (GRCm38) splice site probably benign
IGL02303:Csmd2 APN 4 128,369,008 (GRCm38) missense probably benign 0.01
IGL02317:Csmd2 APN 4 128,463,727 (GRCm38) splice site probably benign
IGL02322:Csmd2 APN 4 128,463,727 (GRCm38) splice site probably benign
IGL02338:Csmd2 APN 4 128,395,066 (GRCm38) missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128,513,372 (GRCm38) splice site probably benign
IGL02428:Csmd2 APN 4 128,474,816 (GRCm38) missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128,534,257 (GRCm38) missense probably benign
IGL02701:Csmd2 APN 4 128,496,141 (GRCm38) missense probably benign 0.17
IGL02801:Csmd2 APN 4 128,552,075 (GRCm38) splice site probably null
IGL02818:Csmd2 APN 4 128,209,728 (GRCm38) missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128,521,884 (GRCm38) missense probably benign 0.00
IGL02876:Csmd2 APN 4 128,321,335 (GRCm38) nonsense probably null
IGL02977:Csmd2 APN 4 128,493,276 (GRCm38) nonsense probably null
IGL03006:Csmd2 APN 4 128,480,765 (GRCm38) splice site probably benign
IGL03032:Csmd2 APN 4 128,519,041 (GRCm38) missense probably benign 0.03
IGL03148:Csmd2 APN 4 128,384,269 (GRCm38) missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128,414,299 (GRCm38) nonsense probably null
IGL03245:Csmd2 APN 4 128,509,122 (GRCm38) missense probably benign 0.12
IGL03376:Csmd2 APN 4 128,517,671 (GRCm38) missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128,296,429 (GRCm38) missense probably benign 0.01
R0109:Csmd2 UTSW 4 128,544,743 (GRCm38) missense probably benign 0.03
R0112:Csmd2 UTSW 4 128,496,029 (GRCm38) missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128,521,911 (GRCm38) missense probably benign 0.02
R0390:Csmd2 UTSW 4 128,133,673 (GRCm38) intron probably benign
R0441:Csmd2 UTSW 4 128,520,230 (GRCm38) missense probably benign 0.00
R0743:Csmd2 UTSW 4 128,113,676 (GRCm38) missense probably benign 0.00
R0746:Csmd2 UTSW 4 128,414,297 (GRCm38) missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128,496,188 (GRCm38) missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128,522,014 (GRCm38) missense probably benign 0.00
R1476:Csmd2 UTSW 4 128,487,001 (GRCm38) missense probably benign 0.08
R1641:Csmd2 UTSW 4 128,483,395 (GRCm38) missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128,496,195 (GRCm38) missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128,414,392 (GRCm38) critical splice donor site probably null
R2870:Csmd2 UTSW 4 128,557,718 (GRCm38) missense unknown
R2870:Csmd2 UTSW 4 128,557,718 (GRCm38) missense unknown
R2871:Csmd2 UTSW 4 128,557,718 (GRCm38) missense unknown
R2871:Csmd2 UTSW 4 128,557,718 (GRCm38) missense unknown
R2872:Csmd2 UTSW 4 128,557,718 (GRCm38) missense unknown
R2872:Csmd2 UTSW 4 128,557,718 (GRCm38) missense unknown
R2873:Csmd2 UTSW 4 128,557,718 (GRCm38) missense unknown
R2893:Csmd2 UTSW 4 128,538,993 (GRCm38) splice site probably null
R3796:Csmd2 UTSW 4 128,517,595 (GRCm38) missense probably benign 0.20
R3797:Csmd2 UTSW 4 128,517,595 (GRCm38) missense probably benign 0.20
R3798:Csmd2 UTSW 4 128,517,595 (GRCm38) missense probably benign 0.20
R3914:Csmd2 UTSW 4 128,321,324 (GRCm38) missense probably benign 0.07
R4198:Csmd2 UTSW 4 128,510,924 (GRCm38) missense probably benign 0.07
R4489:Csmd2 UTSW 4 128,381,945 (GRCm38) missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128,480,095 (GRCm38) splice site probably null
R4581:Csmd2 UTSW 4 128,369,088 (GRCm38) missense probably benign 0.02
R4599:Csmd2 UTSW 4 127,988,128 (GRCm38) missense probably benign 0.35
R4649:Csmd2 UTSW 4 128,546,073 (GRCm38) missense probably benign
R4706:Csmd2 UTSW 4 128,544,751 (GRCm38) missense probably benign
R4776:Csmd2 UTSW 4 128,442,892 (GRCm38) missense probably benign 0.09
R4838:Csmd2 UTSW 4 128,517,749 (GRCm38) missense probably benign
R4900:Csmd2 UTSW 4 128,452,525 (GRCm38) missense probably benign 0.03
R4999:Csmd2 UTSW 4 128,521,930 (GRCm38) missense probably benign 0.00
R5024:Csmd2 UTSW 4 128,321,348 (GRCm38) missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 128,059,108 (GRCm38) missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128,552,035 (GRCm38) missense probably benign 0.27
R5172:Csmd2 UTSW 4 128,477,397 (GRCm38) missense probably benign 0.10
R5231:Csmd2 UTSW 4 128,546,049 (GRCm38) missense probably benign 0.00
R5279:Csmd2 UTSW 4 128,456,914 (GRCm38) missense probably benign 0.30
R5287:Csmd2 UTSW 4 128,486,884 (GRCm38) missense probably benign 0.01
R5403:Csmd2 UTSW 4 128,486,884 (GRCm38) missense probably benign 0.01
R5410:Csmd2 UTSW 4 128,548,819 (GRCm38) missense probably benign
R5551:Csmd2 UTSW 4 128,510,948 (GRCm38) missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128,462,889 (GRCm38) critical splice donor site probably null
R5826:Csmd2 UTSW 4 128,519,199 (GRCm38) splice site probably null
R5907:Csmd2 UTSW 4 128,197,385 (GRCm38) missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128,551,988 (GRCm38) missense probably benign 0.01
R5970:Csmd2 UTSW 4 128,546,151 (GRCm38) missense probably benign 0.00
R5977:Csmd2 UTSW 4 128,059,034 (GRCm38) missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128,559,946 (GRCm38) missense unknown
R6075:Csmd2 UTSW 4 128,486,865 (GRCm38) missense probably benign 0.15
R6129:Csmd2 UTSW 4 128,493,334 (GRCm38) missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128,400,379 (GRCm38) missense probably benign 0.00
R6366:Csmd2 UTSW 4 128,483,452 (GRCm38) missense probably benign 0.00
R6404:Csmd2 UTSW 4 128,521,950 (GRCm38) missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127,988,100 (GRCm38) missense probably benign 0.24
R6441:Csmd2 UTSW 4 128,394,964 (GRCm38) missense probably benign 0.03
R6643:Csmd2 UTSW 4 128,372,597 (GRCm38) missense probably benign 0.14
R6724:Csmd2 UTSW 4 128,563,371 (GRCm38) missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128,463,813 (GRCm38) missense probably benign 0.00
R6750:Csmd2 UTSW 4 128,197,225 (GRCm38) missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128,383,950 (GRCm38) missense probably benign 0.11
R6842:Csmd2 UTSW 4 128,509,159 (GRCm38) missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128,463,794 (GRCm38) missense probably benign 0.27
R6868:Csmd2 UTSW 4 128,442,840 (GRCm38) missense probably benign
R6882:Csmd2 UTSW 4 128,449,269 (GRCm38) missense probably benign 0.01
R7019:Csmd2 UTSW 4 128,369,063 (GRCm38) missense
R7028:Csmd2 UTSW 4 128,277,228 (GRCm38) missense
R7096:Csmd2 UTSW 4 128,462,726 (GRCm38) missense
R7122:Csmd2 UTSW 4 128,449,227 (GRCm38) missense
R7125:Csmd2 UTSW 4 128,496,162 (GRCm38) missense
R7197:Csmd2 UTSW 4 128,511,033 (GRCm38) missense
R7234:Csmd2 UTSW 4 128,456,779 (GRCm38) missense
R7299:Csmd2 UTSW 4 128,528,262 (GRCm38) missense
R7301:Csmd2 UTSW 4 128,528,262 (GRCm38) missense
R7319:Csmd2 UTSW 4 128,393,679 (GRCm38) missense
R7331:Csmd2 UTSW 4 128,564,228 (GRCm38) splice site probably null
R7332:Csmd2 UTSW 4 128,419,567 (GRCm38) missense
R7352:Csmd2 UTSW 4 128,557,636 (GRCm38) missense
R7402:Csmd2 UTSW 4 128,322,096 (GRCm38) missense
R7402:Csmd2 UTSW 4 128,322,095 (GRCm38) missense
R7474:Csmd2 UTSW 4 128,546,127 (GRCm38) missense
R7555:Csmd2 UTSW 4 128,452,458 (GRCm38) missense
R7592:Csmd2 UTSW 4 128,463,798 (GRCm38) missense
R7700:Csmd2 UTSW 4 128,545,756 (GRCm38) splice site probably null
R7714:Csmd2 UTSW 4 128,382,950 (GRCm38) nonsense probably null
R7734:Csmd2 UTSW 4 128,552,057 (GRCm38) missense
R7735:Csmd2 UTSW 4 128,456,930 (GRCm38) critical splice donor site probably null
R7757:Csmd2 UTSW 4 128,483,456 (GRCm38) missense
R7805:Csmd2 UTSW 4 128,419,573 (GRCm38) missense
R7823:Csmd2 UTSW 4 128,209,905 (GRCm38) missense
R7904:Csmd2 UTSW 4 128,419,553 (GRCm38) missense
R7946:Csmd2 UTSW 4 128,520,265 (GRCm38) missense
R7964:Csmd2 UTSW 4 128,523,510 (GRCm38) missense
R7968:Csmd2 UTSW 4 128,197,325 (GRCm38) missense
R8003:Csmd2 UTSW 4 128,539,187 (GRCm38) nonsense probably null
R8071:Csmd2 UTSW 4 128,393,538 (GRCm38) missense
R8504:Csmd2 UTSW 4 128,546,690 (GRCm38) missense
R8511:Csmd2 UTSW 4 128,368,899 (GRCm38) missense
R8517:Csmd2 UTSW 4 128,552,686 (GRCm38) missense
R8704:Csmd2 UTSW 4 128,197,354 (GRCm38) missense
R8722:Csmd2 UTSW 4 128,551,950 (GRCm38) unclassified probably benign
R8729:Csmd2 UTSW 4 128,462,845 (GRCm38) missense
R8801:Csmd2 UTSW 4 128,563,402 (GRCm38) missense probably damaging 0.97
R8803:Csmd2 UTSW 4 128,546,684 (GRCm38) missense
R8839:Csmd2 UTSW 4 128,442,888 (GRCm38) missense
R8867:Csmd2 UTSW 4 128,557,676 (GRCm38) missense
R8913:Csmd2 UTSW 4 128,523,558 (GRCm38) missense
R8928:Csmd2 UTSW 4 128,475,789 (GRCm38) missense
R8974:Csmd2 UTSW 4 128,552,587 (GRCm38) missense
R9001:Csmd2 UTSW 4 128,414,286 (GRCm38) missense
R9132:Csmd2 UTSW 4 128,549,214 (GRCm38) missense
R9245:Csmd2 UTSW 4 128,306,375 (GRCm38) missense
R9249:Csmd2 UTSW 4 128,419,530 (GRCm38) nonsense probably null
R9254:Csmd2 UTSW 4 128,197,319 (GRCm38) missense
R9265:Csmd2 UTSW 4 128,400,370 (GRCm38) missense
R9407:Csmd2 UTSW 4 128,548,820 (GRCm38) missense
R9432:Csmd2 UTSW 4 128,277,211 (GRCm38) missense
R9559:Csmd2 UTSW 4 128,544,768 (GRCm38) missense
R9673:Csmd2 UTSW 4 128,414,269 (GRCm38) missense
R9735:Csmd2 UTSW 4 128,509,108 (GRCm38) missense
R9749:Csmd2 UTSW 4 128,496,128 (GRCm38) missense
R9803:Csmd2 UTSW 4 128,369,193 (GRCm38) missense
Z1177:Csmd2 UTSW 4 128,530,797 (GRCm38) missense
Predicted Primers PCR Primer
(F):5'- TTGAACTTCTCCACGGAGCCCAAC -3'
(R):5'- TCTGGCACAAACTGGGCATACC -3'

Sequencing Primer
(F):5'- ACCACGACTTCTTAGAAATCCG -3'
(R):5'- ATACCTTAGCTGTCTGTCAAACTGG -3'
Posted On 2013-06-12