Incidental Mutation 'R6045:Scel'
ID 483806
Institutional Source Beutler Lab
Gene Symbol Scel
Ensembl Gene ENSMUSG00000022123
Gene Name sciellin
Synonyms 9230114I02Rik
MMRRC Submission 044213-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6045 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 103513342-103612797 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103592213 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 435 (C435R)
Ref Sequence ENSEMBL: ENSMUSP00000154402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]
AlphaFold Q9EQG3
Predicted Effect probably benign
Transcript: ENSMUST00000095576
AA Change: C455R

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123
AA Change: C455R

DomainStartEndE-ValueType
low complexity region 111 131 N/A INTRINSIC
low complexity region 159 178 N/A INTRINSIC
internal_repeat_1 204 327 9.24e-7 PROSPERO
internal_repeat_1 378 505 9.24e-7 PROSPERO
low complexity region 525 537 N/A INTRINSIC
LIM 584 642 2.23e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227322
AA Change: C435R

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik T C 8: 79,229,367 Y87C probably benign Het
5530401A14Rik A G 11: 81,893,868 probably benign Het
5830473C10Rik A T 5: 90,584,989 Q553L possibly damaging Het
Adamts5 T C 16: 85,899,300 D323G probably damaging Het
Bicc1 G A 10: 70,957,081 R248* probably null Het
Bivm T G 1: 44,119,073 probably benign Het
Ccdc8 A C 7: 16,996,031 T482P unknown Het
Ccnb2 T C 9: 70,419,093 I21V probably benign Het
Cfap73 A T 5: 120,631,712 I82N probably damaging Het
Chd3 A C 11: 69,352,118 F1426V possibly damaging Het
Clcn2 A T 16: 20,711,688 probably null Het
Col6a5 T C 9: 105,925,918 N1283D unknown Het
Cyp39a1 G T 17: 43,731,991 G411W probably damaging Het
D130052B06Rik A T 11: 33,624,008 I202L unknown Het
Dlgap1 T C 17: 70,818,098 L948P probably damaging Het
Dnah3 C T 7: 119,967,522 V2494M probably damaging Het
Dysf T A 6: 84,114,072 V1076D probably damaging Het
Eif2ak4 C A 2: 118,388,815 S36* probably null Het
Elmod3 C T 6: 72,568,868 R297H probably benign Het
Epas1 C A 17: 86,809,399 R166S probably damaging Het
Erv3 A G 2: 131,856,022 L139P probably damaging Het
Fryl A G 5: 73,118,551 V90A probably damaging Het
Fxr2 A G 11: 69,651,051 R439G possibly damaging Het
Gabrd A T 4: 155,386,474 V259D possibly damaging Het
Galnt10 A G 11: 57,783,793 Y536C probably damaging Het
Gbp10 A T 5: 105,218,403 L545Q probably damaging Het
Gfpt1 A T 6: 87,085,257 I517F probably damaging Het
Glb1 T C 9: 114,437,942 Y225H probably damaging Het
Gm1110 C T 9: 26,883,209 probably null Het
Gm14851 A T 8: 21,095,232 C65S possibly damaging Het
Gm36028 G T 16: 37,856,022 Q128K probably benign Het
Gmps C T 3: 63,980,137 P10L probably benign Het
Greb1l T A 18: 10,547,068 V1465D probably damaging Het
Helz2 A G 2: 181,240,313 V229A probably benign Het
Hipk1 A T 3: 103,746,902 L924Q probably benign Het
Ifngr1 T G 10: 19,609,161 L303V possibly damaging Het
Kif22 T C 7: 127,031,078 N429D probably benign Het
Ktn1 T C 14: 47,676,796 Y401H probably damaging Het
Lars2 T G 9: 123,371,988 I39S probably damaging Het
Lipf C T 19: 33,966,844 A151V probably damaging Het
Lrp1 A T 10: 127,566,600 M2234K probably damaging Het
Lrp1b A G 2: 40,701,813 V56A unknown Het
Lyar T A 5: 38,234,008 H350Q probably benign Het
Mill2 A T 7: 18,856,564 M190L probably benign Het
Morc3 A G 16: 93,874,845 D921G probably damaging Het
Mpp2 G T 11: 102,059,354 T558K probably benign Het
Myh4 A G 11: 67,244,724 D379G probably benign Het
Neb A C 2: 52,194,425 probably null Het
Nedd1 G A 10: 92,695,100 R376* probably null Het
Nlrc4 T G 17: 74,446,959 D143A probably damaging Het
Nol10 G T 12: 17,348,478 probably benign Het
Olfr1316 T G 2: 112,130,536 I92L possibly damaging Het
Olfr1404 C T 1: 173,216,500 T283I possibly damaging Het
Olfr1431 C A 19: 12,210,295 A243D probably damaging Het
Olfr197 T A 16: 59,186,091 T131S probably benign Het
Olfr652 C T 7: 104,564,767 T182I probably benign Het
Opn1sw A G 6: 29,379,870 S122P probably damaging Het
Orm1 T A 4: 63,344,692 I32N possibly damaging Het
Pcdhb5 T A 18: 37,321,575 V336E probably damaging Het
Poli C T 18: 70,517,469 R363K possibly damaging Het
Rabgap1l T C 1: 160,645,323 E515G probably benign Het
Rem2 C A 14: 54,477,768 T134N probably damaging Het
Rfc1 A G 5: 65,279,549 I596T probably damaging Het
Ruvbl2 A T 7: 45,425,009 I202N probably damaging Het
S100a6 T A 3: 90,613,879 I38N probably damaging Het
Slc6a13 T A 6: 121,321,628 W146R probably damaging Het
Sorcs1 T A 19: 50,190,117 K856* probably null Het
Speer4e T G 5: 14,937,181 K70T possibly damaging Het
Sucla2 T A 14: 73,568,964 C158* probably null Het
Tie1 G A 4: 118,484,691 S187L probably benign Het
Tmem200a T C 10: 25,993,007 T455A probably damaging Het
Tra2a A G 6: 49,252,464 probably benign Het
Tsnaxip1 A C 8: 105,844,187 E615A probably benign Het
Tuba3b T A 6: 145,621,174 N380K probably damaging Het
Umod C T 7: 119,476,823 S240N probably benign Het
Vmn2r92 G A 17: 18,168,043 probably null Het
Vps13b A G 15: 35,671,316 E1655G probably damaging Het
Vwde A T 6: 13,219,936 I72N probably damaging Het
Wbp11 G A 6: 136,821,535 A172V probably damaging Het
Zbtb41 T A 1: 139,424,032 N294K probably benign Het
Zfhx4 T A 3: 5,396,959 H1206Q probably damaging Het
Other mutations in Scel
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Scel APN 14 103529995 missense probably benign 0.01
IGL00913:Scel APN 14 103581809 missense probably benign 0.35
IGL01086:Scel APN 14 103612391 missense probably benign 0.05
IGL01352:Scel APN 14 103533338 missense possibly damaging 0.54
IGL01396:Scel APN 14 103608094 splice site probably benign
IGL01954:Scel APN 14 103603242 splice site probably benign
IGL02064:Scel APN 14 103533326 missense probably damaging 0.98
IGL02186:Scel APN 14 103564821 missense probably benign 0.23
IGL02475:Scel APN 14 103537008 missense possibly damaging 0.95
IGL02926:Scel APN 14 103576247 nonsense probably null
IGL03122:Scel APN 14 103599406 missense possibly damaging 0.66
IGL03135:Scel APN 14 103586514 missense probably benign 0.02
PIT4585001:Scel UTSW 14 103592368 missense possibly damaging 0.90
R0346:Scel UTSW 14 103529984 missense probably damaging 1.00
R0394:Scel UTSW 14 103562518 missense probably benign 0.15
R0418:Scel UTSW 14 103603254 missense probably benign
R0635:Scel UTSW 14 103583139 critical splice donor site probably null
R0815:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0863:Scel UTSW 14 103586480 missense possibly damaging 0.83
R0990:Scel UTSW 14 103581832 missense possibly damaging 0.55
R1084:Scel UTSW 14 103564843 critical splice donor site probably null
R1641:Scel UTSW 14 103533316 missense probably damaging 1.00
R2001:Scel UTSW 14 103610790 missense possibly damaging 0.66
R2002:Scel UTSW 14 103541985 missense probably damaging 1.00
R2341:Scel UTSW 14 103608170 missense possibly damaging 0.92
R3425:Scel UTSW 14 103608106 missense possibly damaging 0.92
R3836:Scel UTSW 14 103592386 missense possibly damaging 0.66
R4035:Scel UTSW 14 103530004 missense probably damaging 1.00
R4197:Scel UTSW 14 103599400 missense probably damaging 0.97
R4737:Scel UTSW 14 103572037 missense possibly damaging 0.79
R4801:Scel UTSW 14 103583100 missense probably benign 0.01
R4802:Scel UTSW 14 103583100 missense probably benign 0.01
R5369:Scel UTSW 14 103586493 missense probably benign 0.00
R5555:Scel UTSW 14 103602206 missense probably benign 0.27
R5582:Scel UTSW 14 103583139 critical splice donor site probably benign
R5931:Scel UTSW 14 103605624 nonsense probably null
R5978:Scel UTSW 14 103529254 splice site probably null
R6062:Scel UTSW 14 103585136 missense possibly damaging 0.82
R6218:Scel UTSW 14 103572042 missense probably benign 0.12
R6225:Scel UTSW 14 103591984 missense probably benign 0.27
R7102:Scel UTSW 14 103543832 nonsense probably null
R7349:Scel UTSW 14 103543879 missense probably benign 0.11
R8376:Scel UTSW 14 103572015 missense probably benign 0.02
R8924:Scel UTSW 14 103592371 missense possibly damaging 0.66
R9014:Scel UTSW 14 103585139 missense probably benign
R9130:Scel UTSW 14 103533310 missense probably benign 0.05
R9135:Scel UTSW 14 103602190 missense probably benign
R9179:Scel UTSW 14 103574400 missense possibly damaging 0.79
R9614:Scel UTSW 14 103605596 missense probably damaging 1.00
R9638:Scel UTSW 14 103541973 missense possibly damaging 0.89
R9672:Scel UTSW 14 103599402 missense possibly damaging 0.82
R9719:Scel UTSW 14 103572006 critical splice acceptor site probably null
X0026:Scel UTSW 14 103591993 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TGATGTTCTCACAAACAACCAAAGG -3'
(R):5'- TAGGTTCACCTACCCATTTGTG -3'

Posted On 2017-07-14