Incidental Mutation 'R6045:Morc3'
ID483812
Institutional Source Beutler Lab
Gene Symbol Morc3
Ensembl Gene ENSMUSG00000039456
Gene Namemicrorchidia 3
SynonymsZcwcc3, 1110051N18Rik, 1110051N18Rik, D16Jhu32e
MMRRC Submission 044213-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6045 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location93832121-93876073 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93874845 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 921 (D921G)
Ref Sequence ENSEMBL: ENSMUSP00000144369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044068] [ENSMUST00000201097] [ENSMUST00000202261]
Predicted Effect probably damaging
Transcript: ENSMUST00000044068
AA Change: D921G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040152
Gene: ENSMUSG00000039456
AA Change: D921G

DomainStartEndE-ValueType
Pfam:HATPase_c 25 130 8e-8 PFAM
Pfam:HATPase_c_3 26 164 1.1e-18 PFAM
Pfam:zf-CW 409 452 2.7e-19 PFAM
low complexity region 461 472 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
coiled coil region 765 871 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201097
AA Change: D848G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144058
Gene: ENSMUSG00000039456
AA Change: D848G

DomainStartEndE-ValueType
Blast:HATPase_c 1 70 4e-39 BLAST
Pfam:zf-CW 340 383 1.2e-16 PFAM
low complexity region 392 403 N/A INTRINSIC
low complexity region 557 566 N/A INTRINSIC
coiled coil region 692 798 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202261
AA Change: D921G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144369
Gene: ENSMUSG00000039456
AA Change: D921G

DomainStartEndE-ValueType
Pfam:HATPase_c 25 130 8e-8 PFAM
Pfam:HATPase_c_3 26 164 1.1e-18 PFAM
Pfam:zf-CW 409 452 2.7e-19 PFAM
low complexity region 461 472 N/A INTRINSIC
low complexity region 630 639 N/A INTRINSIC
coiled coil region 765 871 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232425
Predicted Effect probably benign
Transcript: ENSMUST00000232639
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that localizes to the nuclear matrix and forms nuclear bodies via an ATP-dependent mechanism. The protein is predicted to have coiled-coil and zinc finger domains and has RNA binding activity. Alternative splicing produces multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a null allele die at or within a day of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik T C 8: 79,229,367 Y87C probably benign Het
5530401A14Rik A G 11: 81,893,868 probably benign Het
5830473C10Rik A T 5: 90,584,989 Q553L possibly damaging Het
Adamts5 T C 16: 85,899,300 D323G probably damaging Het
Bicc1 G A 10: 70,957,081 R248* probably null Het
Bivm T G 1: 44,119,073 probably benign Het
Ccdc8 A C 7: 16,996,031 T482P unknown Het
Ccnb2 T C 9: 70,419,093 I21V probably benign Het
Cfap73 A T 5: 120,631,712 I82N probably damaging Het
Chd3 A C 11: 69,352,118 F1426V possibly damaging Het
Clcn2 A T 16: 20,711,688 probably null Het
Col6a5 T C 9: 105,925,918 N1283D unknown Het
Cyp39a1 G T 17: 43,731,991 G411W probably damaging Het
D130052B06Rik A T 11: 33,624,008 I202L unknown Het
Dlgap1 T C 17: 70,818,098 L948P probably damaging Het
Dnah3 C T 7: 119,967,522 V2494M probably damaging Het
Dysf T A 6: 84,114,072 V1076D probably damaging Het
Eif2ak4 C A 2: 118,388,815 S36* probably null Het
Elmod3 C T 6: 72,568,868 R297H probably benign Het
Epas1 C A 17: 86,809,399 R166S probably damaging Het
Erv3 A G 2: 131,856,022 L139P probably damaging Het
Fryl A G 5: 73,118,551 V90A probably damaging Het
Fxr2 A G 11: 69,651,051 R439G possibly damaging Het
Gabrd A T 4: 155,386,474 V259D possibly damaging Het
Galnt10 A G 11: 57,783,793 Y536C probably damaging Het
Gbp10 A T 5: 105,218,403 L545Q probably damaging Het
Gfpt1 A T 6: 87,085,257 I517F probably damaging Het
Glb1 T C 9: 114,437,942 Y225H probably damaging Het
Gm1110 C T 9: 26,883,209 probably null Het
Gm14851 A T 8: 21,095,232 C65S possibly damaging Het
Gm36028 G T 16: 37,856,022 Q128K probably benign Het
Gmps C T 3: 63,980,137 P10L probably benign Het
Greb1l T A 18: 10,547,068 V1465D probably damaging Het
Helz2 A G 2: 181,240,313 V229A probably benign Het
Hipk1 A T 3: 103,746,902 L924Q probably benign Het
Ifngr1 T G 10: 19,609,161 L303V possibly damaging Het
Kif22 T C 7: 127,031,078 N429D probably benign Het
Ktn1 T C 14: 47,676,796 Y401H probably damaging Het
Lars2 T G 9: 123,371,988 I39S probably damaging Het
Lipf C T 19: 33,966,844 A151V probably damaging Het
Lrp1 A T 10: 127,566,600 M2234K probably damaging Het
Lrp1b A G 2: 40,701,813 V56A unknown Het
Lyar T A 5: 38,234,008 H350Q probably benign Het
Mill2 A T 7: 18,856,564 M190L probably benign Het
Mpp2 G T 11: 102,059,354 T558K probably benign Het
Myh4 A G 11: 67,244,724 D379G probably benign Het
Neb A C 2: 52,194,425 probably null Het
Nedd1 G A 10: 92,695,100 R376* probably null Het
Nlrc4 T G 17: 74,446,959 D143A probably damaging Het
Nol10 G T 12: 17,348,478 probably benign Het
Olfr1316 T G 2: 112,130,536 I92L possibly damaging Het
Olfr1404 C T 1: 173,216,500 T283I possibly damaging Het
Olfr1431 C A 19: 12,210,295 A243D probably damaging Het
Olfr197 T A 16: 59,186,091 T131S probably benign Het
Olfr652 C T 7: 104,564,767 T182I probably benign Het
Opn1sw A G 6: 29,379,870 S122P probably damaging Het
Orm1 T A 4: 63,344,692 I32N possibly damaging Het
Pcdhb5 T A 18: 37,321,575 V336E probably damaging Het
Poli C T 18: 70,517,469 R363K possibly damaging Het
Rabgap1l T C 1: 160,645,323 E515G probably benign Het
Rem2 C A 14: 54,477,768 T134N probably damaging Het
Rfc1 A G 5: 65,279,549 I596T probably damaging Het
Ruvbl2 A T 7: 45,425,009 I202N probably damaging Het
S100a6 T A 3: 90,613,879 I38N probably damaging Het
Scel T C 14: 103,592,213 C435R probably benign Het
Slc6a13 T A 6: 121,321,628 W146R probably damaging Het
Sorcs1 T A 19: 50,190,117 K856* probably null Het
Speer4e T G 5: 14,937,181 K70T possibly damaging Het
Sucla2 T A 14: 73,568,964 C158* probably null Het
Tie1 G A 4: 118,484,691 S187L probably benign Het
Tmem200a T C 10: 25,993,007 T455A probably damaging Het
Tra2a A G 6: 49,252,464 probably benign Het
Tsnaxip1 A C 8: 105,844,187 E615A probably benign Het
Tuba3b T A 6: 145,621,174 N380K probably damaging Het
Umod C T 7: 119,476,823 S240N probably benign Het
Vmn2r92 G A 17: 18,168,043 probably null Het
Vps13b A G 15: 35,671,316 E1655G probably damaging Het
Vwde A T 6: 13,219,936 I72N probably damaging Het
Wbp11 G A 6: 136,821,535 A172V probably damaging Het
Zbtb41 T A 1: 139,424,032 N294K probably benign Het
Zfhx4 T A 3: 5,396,959 H1206Q probably damaging Het
Other mutations in Morc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Morc3 APN 16 93873395 critical splice donor site probably null
IGL01015:Morc3 APN 16 93862646 missense probably damaging 1.00
IGL01374:Morc3 APN 16 93844213 missense probably damaging 1.00
IGL01634:Morc3 APN 16 93873237 missense probably benign 0.02
IGL01845:Morc3 APN 16 93860567 missense probably damaging 0.96
IGL02202:Morc3 APN 16 93870861 missense probably benign 0.01
IGL02478:Morc3 APN 16 93864956 splice site probably benign
IGL03026:Morc3 APN 16 93862724 splice site probably benign
IGL03115:Morc3 APN 16 93871083 missense probably damaging 0.99
mindy UTSW 16 93866533 missense probably benign 0.03
Pfaff UTSW 16 93862684 missense probably damaging 0.96
shield UTSW 16 93874812 missense probably damaging 0.98
Stooges UTSW 16 93841387 missense probably damaging 1.00
Sword UTSW 16 93874757 critical splice acceptor site probably null
R0173:Morc3 UTSW 16 93832206 utr 5 prime probably null
R0413:Morc3 UTSW 16 93870474 missense probably damaging 1.00
R0639:Morc3 UTSW 16 93853850 missense probably damaging 1.00
R0842:Morc3 UTSW 16 93873396 critical splice donor site probably null
R1134:Morc3 UTSW 16 93870669 missense probably benign
R1162:Morc3 UTSW 16 93853108 missense probably damaging 1.00
R1498:Morc3 UTSW 16 93853855 missense probably damaging 1.00
R1520:Morc3 UTSW 16 93844241 missense probably damaging 0.96
R1603:Morc3 UTSW 16 93866503 missense probably benign
R1622:Morc3 UTSW 16 93874806 missense probably benign 0.28
R1630:Morc3 UTSW 16 93866533 missense probably benign 0.03
R1818:Morc3 UTSW 16 93855510 missense probably damaging 1.00
R1902:Morc3 UTSW 16 93870497 missense probably damaging 1.00
R2090:Morc3 UTSW 16 93866453 missense probably benign 0.23
R2261:Morc3 UTSW 16 93853221 splice site probably benign
R2360:Morc3 UTSW 16 93841387 missense probably damaging 1.00
R2407:Morc3 UTSW 16 93844327 critical splice donor site probably null
R2519:Morc3 UTSW 16 93862539 splice site probably null
R3736:Morc3 UTSW 16 93874812 missense probably damaging 0.98
R3873:Morc3 UTSW 16 93862436 missense probably damaging 0.99
R4114:Morc3 UTSW 16 93873339 missense probably benign 0.01
R4115:Morc3 UTSW 16 93873339 missense probably benign 0.01
R4116:Morc3 UTSW 16 93873339 missense probably benign 0.01
R4472:Morc3 UTSW 16 93874757 critical splice acceptor site probably null
R4609:Morc3 UTSW 16 93864968 missense probably benign 0.01
R4708:Morc3 UTSW 16 93873238 missense probably benign 0.19
R4883:Morc3 UTSW 16 93870362 critical splice acceptor site probably null
R4945:Morc3 UTSW 16 93871194 missense probably damaging 1.00
R4965:Morc3 UTSW 16 93860587 nonsense probably null
R5399:Morc3 UTSW 16 93862539 splice site probably null
R5481:Morc3 UTSW 16 93862655 missense probably damaging 0.99
R5540:Morc3 UTSW 16 93847380 missense probably benign
R5970:Morc3 UTSW 16 93866453 missense possibly damaging 0.65
R6006:Morc3 UTSW 16 93866493 missense possibly damaging 0.67
R6044:Morc3 UTSW 16 93866442 missense probably benign 0.02
R6155:Morc3 UTSW 16 93862425 missense possibly damaging 0.94
R6165:Morc3 UTSW 16 93841383 missense probably damaging 1.00
R6225:Morc3 UTSW 16 93845194 nonsense probably null
R6240:Morc3 UTSW 16 93862684 missense probably damaging 0.96
R6835:Morc3 UTSW 16 93847421 missense probably damaging 1.00
R6918:Morc3 UTSW 16 93853135 missense probably benign 0.36
R6944:Morc3 UTSW 16 93870572 missense probably benign
R7311:Morc3 UTSW 16 93849173 missense probably damaging 1.00
R7398:Morc3 UTSW 16 93874860 missense probably damaging 1.00
R7553:Morc3 UTSW 16 93870936 missense probably damaging 0.98
X0023:Morc3 UTSW 16 93847399 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCTAGTGAATCCATTGGCTG -3'
(R):5'- TGGGACACTCGAATGCATAG -3'

Posted On2017-07-14