Mutagenetix > Incidental Mutations

Incidental Mutation 'R0519:Clip2'

48382

Institutional Source

Beutler Lab

Gene Symbol

Clip2

Ensembl Gene

ENSMUSG00000063146

Gene Name

CAP-GLY domain containing linker protein 2

Synonyms

WSCR4, Cyln2, CLIP-115

MMRRC Submission

038712-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.238) question?

Stock #

R0519 (G1)

Quality Score

136

Status

Validated

Chromosome

Chromosomal Location

134489383-134552434 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 134516151 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 383 (V383A)

Ref Sequence

ENSEMBL: ENSMUSP00000098212 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036999] [ENSMUST00000100647]

Predicted Effect

probably benign
Transcript: ENSMUST00000036999
AA Change: V383A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000037431
Gene: ENSMUSG00000063146
AA Change: V383A

Domain	Start	End	E-Value	Type
low complexity region	17	39	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
CAP_GLY	82	147	2.72e-30	SMART
CAP_GLY	222	287	1.15e-33	SMART
low complexity region	315	339	N/A	INTRINSIC
coiled coil region	355	457	N/A	INTRINSIC
low complexity region	504	519	N/A	INTRINSIC
coiled coil region	529	578	N/A	INTRINSIC
coiled coil region	640	982	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000100647
AA Change: V383A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000098212
Gene: ENSMUSG00000063146
AA Change: V383A

Domain	Start	End	E-Value	Type
low complexity region	17	39	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
CAP_GLY	82	147	2.72e-30	SMART
CAP_GLY	222	287	1.15e-33	SMART
low complexity region	315	339	N/A	INTRINSIC
coiled coil region	355	496	N/A	INTRINSIC
low complexity region	539	554	N/A	INTRINSIC
coiled coil region	564	613	N/A	INTRINSIC
coiled coil region	675	1017	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202408

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202895

Meta Mutation Damage Score

0.0633

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.6%
20x: 93.2%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of cytoplasmic linker proteins, which have been proposed to mediate the interaction between specific membranous organelles and microtubules. This protein was found to associate with both microtubules and an organelle called the dendritic lamellar body. This gene is hemizygously deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous and heterozygous for disruptions in this gene display growth deficiency, brain abnormalities and hippocampal dysfunction and deficits in motor coordination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700028K03Rik	A	G	5: 107,548,201	R168G	probably benign	Het
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
2810004N23Rik	C	T	8: 124,839,929	G251R	possibly damaging	Het
3425401B19Rik	A	G	14: 32,662,962	S349P	possibly damaging	Het
Ackr4	A	G	9: 104,099,451	V99A	probably benign	Het
Asxl3	A	G	18: 22,523,520	Q1529R	possibly damaging	Het
Atg12	T	C	18: 46,741,410	E46G	probably benign	Het
Cdcp2	A	G	4: 107,107,192		probably benign	Het
Clasrp	A	G	7: 19,584,164		probably benign	Het
Cntln	C	T	4: 85,005,053		probably benign	Het
Colgalt2	G	T	1: 152,508,561	A551S	possibly damaging	Het
Csmd2	A	C	4: 128,487,005	Y2118S	possibly damaging	Het
Dip2c	T	A	13: 9,563,208	V415E	probably damaging	Het
Dpy19l2	C	T	9: 24,558,095	R755Q	probably benign	Het
Dsn1	A	T	2: 156,998,713		probably benign	Het
Dtd2	T	C	12: 52,004,959		probably benign	Het
Dync1i1	A	G	6: 6,027,399	T602A	probably benign	Het
Ercc6	A	C	14: 32,526,842	D450A	probably damaging	Het
Fgf12	A	T	16: 28,189,628	V104D	probably benign	Het
Frem1	A	T	4: 82,970,633		probably null	Het
Gcgr	G	T	11: 120,536,156	W88L	probably damaging	Het
Glb1	ACCC	ACC	9: 114,421,744		probably null	Het
Hapln1	A	G	13: 89,584,716		probably benign	Het
Hmgn3	T	C	9: 83,112,248	E40G	probably damaging	Het
Hsdl1	G	A	8: 119,565,711	A255V	probably damaging	Het
Hyls1	T	C	9: 35,561,203	K306E	probably damaging	Het
Jcad	C	T	18: 4,649,122		probably benign	Het
Kif14	C	A	1: 136,469,147	A397E	probably damaging	Het
Lcmt2	A	T	2: 121,139,344		probably null	Het
Lifr	T	C	15: 7,177,580	L524P	probably damaging	Het
Ly6g6f	T	C	17: 35,082,852	K209E	possibly damaging	Het
Macf1	G	A	4: 123,471,320	T1651I	probably benign	Het
Mapk4	T	C	18: 73,970,321	D39G	probably damaging	Het
Mbl1	A	G	14: 41,158,565	M137V	probably damaging	Het
Mcm10	G	A	2: 5,008,545	S92L	probably benign	Het
Mug1	A	G	6: 121,851,424	K265R	possibly damaging	Het
Mxra7	A	G	11: 116,810,786		probably null	Het
Neu3	G	A	7: 99,823,317		probably benign	Het
Nsd1	A	G	13: 55,312,835	T2395A	probably benign	Het
Olfr1034	A	T	2: 86,047,067	Y195F	probably benign	Het
Olfr3	T	A	2: 36,812,615	H159L	probably damaging	Het
Olfr750	T	A	14: 51,071,157	I79F	probably damaging	Het
Olfr854	A	T	9: 19,566,949	I145N	probably benign	Het
Osgepl1	T	C	1: 53,321,096	V327A	probably damaging	Het
Pcdhb21	T	C	18: 37,516,032	V738A	possibly damaging	Het
Plekha8	A	T	6: 54,622,107		probably benign	Het
Ptprq	A	C	10: 107,538,920		probably benign	Het
Pus10	T	A	11: 23,711,201	F263Y	probably benign	Het
Rad54b	A	T	4: 11,599,809	I338F	probably damaging	Het
Rad54l2	A	G	9: 106,708,299	F756L	probably damaging	Het
Scn11a	A	G	9: 119,790,119	L719P	probably damaging	Het
Slc2a2	G	A	3: 28,718,816	V253I	possibly damaging	Het
Slc39a4	A	T	15: 76,615,138	N192K	probably benign	Het
Soat1	T	A	1: 156,441,246	I245F	probably damaging	Het
Sorcs2	G	A	5: 36,031,190	A858V	probably benign	Het
Tcim	T	C	8: 24,438,635	T88A	possibly damaging	Het
Tecta	G	A	9: 42,347,892		probably benign	Het
Tgm5	C	A	2: 121,048,895	L553F	probably damaging	Het
Tjp1	A	G	7: 65,302,921	V1555A	probably benign	Het
Tmem214	A	C	5: 30,869,668	M1L	probably null	Het
Togaram1	T	C	12: 64,966,002		probably benign	Het
Topaz1	C	A	9: 122,749,479	L485I	possibly damaging	Het
Ttn	T	C	2: 76,718,282		probably benign	Het
Ube2o	A	G	11: 116,546,459		probably null	Het
Ubr7	T	A	12: 102,768,206	D246E	probably benign	Het
Vcpkmt	T	C	12: 69,582,328	D132G	probably benign	Het
Vmn2r111	T	A	17: 22,573,121	Q51H	probably benign	Het
Vmn2r95	C	T	17: 18,439,503	P170S	probably damaging	Het
Zbtb38	A	G	9: 96,685,773	I1086T	probably damaging	Het
Zfp444	G	A	7: 6,188,173	A118T	probably benign	Het
Zp2	A	G	7: 120,138,149	I272T	probably damaging	Het

Other mutations in Clip2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00500:Clip2	APN	5	134500157	splice site	probably benign
IGL01024:Clip2	APN	5	134510212	missense	probably damaging	1.00
IGL01103:Clip2	APN	5	134492350	missense	possibly damaging	0.64
IGL01726:Clip2	APN	5	134522664	missense	probably damaging	1.00
IGL01833:Clip2	APN	5	134498084	splice site	probably benign
IGL02174:Clip2	APN	5	134494264	missense	probably damaging	1.00
IGL02232:Clip2	APN	5	134503130	missense	probably damaging	1.00
IGL02271:Clip2	APN	5	134502571	missense	probably benign	0.35
IGL02471:Clip2	APN	5	134518022	missense	probably benign	0.04
IGL02690:Clip2	APN	5	134510159	splice site	probably benign
IGL03198:Clip2	APN	5	134498082	splice site	probably benign
IGL03269:Clip2	APN	5	134516894	missense	probably damaging	1.00
scissors	UTSW	5	134517999	nonsense	probably null
R0335:Clip2	UTSW	5	134535215	start gained	probably benign
R0422:Clip2	UTSW	5	134498113	missense	probably benign	0.04
R1169:Clip2	UTSW	5	134492250	missense	probably benign	0.36
R1642:Clip2	UTSW	5	134503253	missense	possibly damaging	0.89
R1718:Clip2	UTSW	5	134502929	nonsense	probably null
R1822:Clip2	UTSW	5	134503227	missense	probably benign	0.01
R1824:Clip2	UTSW	5	134503227	missense	probably benign	0.01
R2011:Clip2	UTSW	5	134503115	missense	probably damaging	1.00
R3106:Clip2	UTSW	5	134523064	missense	probably benign	0.12
R3890:Clip2	UTSW	5	134522993	missense	probably damaging	1.00
R3891:Clip2	UTSW	5	134522993	missense	probably damaging	1.00
R3892:Clip2	UTSW	5	134522993	missense	probably damaging	1.00
R4134:Clip2	UTSW	5	134492253	missense	probably benign	0.08
R4237:Clip2	UTSW	5	134535197	start gained	probably benign
R4239:Clip2	UTSW	5	134535197	start gained	probably benign
R4294:Clip2	UTSW	5	134492313	missense	probably benign	0.09
R4450:Clip2	UTSW	5	134502953	missense	possibly damaging	0.82
R4741:Clip2	UTSW	5	134516269	missense	probably benign	0.02
R5186:Clip2	UTSW	5	134522791	missense	possibly damaging	0.46
R5235:Clip2	UTSW	5	134522791	missense	possibly damaging	0.46
R5409:Clip2	UTSW	5	134522791	missense	possibly damaging	0.46
R5410:Clip2	UTSW	5	134522791	missense	possibly damaging	0.46
R5448:Clip2	UTSW	5	134514048	missense	probably benign	0.01
R5900:Clip2	UTSW	5	134502779	missense	possibly damaging	0.48
R6464:Clip2	UTSW	5	134491925	missense	probably benign	0.00
R7032:Clip2	UTSW	5	134522630	missense	probably damaging	1.00
R7152:Clip2	UTSW	5	134496241	missense	probably damaging	1.00
R7216:Clip2	UTSW	5	134502917	missense	probably benign	0.01
R7358:Clip2	UTSW	5	134502630	nonsense	probably null
R7725:Clip2	UTSW	5	134517999	nonsense	probably null
R8380:Clip2	UTSW	5	134502797	missense	probably damaging	0.96
X0062:Clip2	UTSW	5	134503136	missense	probably benign	0.12
Z1177:Clip2	UTSW	5	134516835	missense	probably damaging	0.98
Z1177:Clip2	UTSW	5	134522999	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAAGGAATCCTCTCTTGGAGTCTTGG -3'
(R):5'- AGTATCTTGAGTCTCGCCCATGCC -3'

Sequencing Primer
(F):5'- cctagaaattgacaaggctcac -3'
(R):5'- GCCCATGCCCACTCTCTG -3'

Posted On

2013-06-12