Incidental Mutation 'R0519:Clip2'
ID48382
Institutional Source Beutler Lab
Gene Symbol Clip2
Ensembl Gene ENSMUSG00000063146
Gene NameCAP-GLY domain containing linker protein 2
SynonymsWSCR4, Cyln2, CLIP-115
MMRRC Submission 038712-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R0519 (G1)
Quality Score136
Status Validated
Chromosome5
Chromosomal Location134489383-134552434 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134516151 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 383 (V383A)
Ref Sequence ENSEMBL: ENSMUSP00000098212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036999] [ENSMUST00000100647]
Predicted Effect probably benign
Transcript: ENSMUST00000036999
AA Change: V383A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000037431
Gene: ENSMUSG00000063146
AA Change: V383A

DomainStartEndE-ValueType
low complexity region 17 39 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
CAP_GLY 82 147 2.72e-30 SMART
CAP_GLY 222 287 1.15e-33 SMART
low complexity region 315 339 N/A INTRINSIC
coiled coil region 355 457 N/A INTRINSIC
low complexity region 504 519 N/A INTRINSIC
coiled coil region 529 578 N/A INTRINSIC
coiled coil region 640 982 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100647
AA Change: V383A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000098212
Gene: ENSMUSG00000063146
AA Change: V383A

DomainStartEndE-ValueType
low complexity region 17 39 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
CAP_GLY 82 147 2.72e-30 SMART
CAP_GLY 222 287 1.15e-33 SMART
low complexity region 315 339 N/A INTRINSIC
coiled coil region 355 496 N/A INTRINSIC
low complexity region 539 554 N/A INTRINSIC
coiled coil region 564 613 N/A INTRINSIC
coiled coil region 675 1017 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202895
Meta Mutation Damage Score 0.0633 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.6%
  • 20x: 93.2%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of cytoplasmic linker proteins, which have been proposed to mediate the interaction between specific membranous organelles and microtubules. This protein was found to associate with both microtubules and an organelle called the dendritic lamellar body. This gene is hemizygously deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous and heterozygous for disruptions in this gene display growth deficiency, brain abnormalities and hippocampal dysfunction and deficits in motor coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028K03Rik A G 5: 107,548,201 R168G probably benign Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2810004N23Rik C T 8: 124,839,929 G251R possibly damaging Het
3425401B19Rik A G 14: 32,662,962 S349P possibly damaging Het
Ackr4 A G 9: 104,099,451 V99A probably benign Het
Asxl3 A G 18: 22,523,520 Q1529R possibly damaging Het
Atg12 T C 18: 46,741,410 E46G probably benign Het
Cdcp2 A G 4: 107,107,192 probably benign Het
Clasrp A G 7: 19,584,164 probably benign Het
Cntln C T 4: 85,005,053 probably benign Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Csmd2 A C 4: 128,487,005 Y2118S possibly damaging Het
Dip2c T A 13: 9,563,208 V415E probably damaging Het
Dpy19l2 C T 9: 24,558,095 R755Q probably benign Het
Dsn1 A T 2: 156,998,713 probably benign Het
Dtd2 T C 12: 52,004,959 probably benign Het
Dync1i1 A G 6: 6,027,399 T602A probably benign Het
Ercc6 A C 14: 32,526,842 D450A probably damaging Het
Fgf12 A T 16: 28,189,628 V104D probably benign Het
Frem1 A T 4: 82,970,633 probably null Het
Gcgr G T 11: 120,536,156 W88L probably damaging Het
Glb1 ACCC ACC 9: 114,421,744 probably null Het
Hapln1 A G 13: 89,584,716 probably benign Het
Hmgn3 T C 9: 83,112,248 E40G probably damaging Het
Hsdl1 G A 8: 119,565,711 A255V probably damaging Het
Hyls1 T C 9: 35,561,203 K306E probably damaging Het
Jcad C T 18: 4,649,122 probably benign Het
Kif14 C A 1: 136,469,147 A397E probably damaging Het
Lcmt2 A T 2: 121,139,344 probably null Het
Lifr T C 15: 7,177,580 L524P probably damaging Het
Ly6g6f T C 17: 35,082,852 K209E possibly damaging Het
Macf1 G A 4: 123,471,320 T1651I probably benign Het
Mapk4 T C 18: 73,970,321 D39G probably damaging Het
Mbl1 A G 14: 41,158,565 M137V probably damaging Het
Mcm10 G A 2: 5,008,545 S92L probably benign Het
Mug1 A G 6: 121,851,424 K265R possibly damaging Het
Mxra7 A G 11: 116,810,786 probably null Het
Neu3 G A 7: 99,823,317 probably benign Het
Nsd1 A G 13: 55,312,835 T2395A probably benign Het
Olfr1034 A T 2: 86,047,067 Y195F probably benign Het
Olfr3 T A 2: 36,812,615 H159L probably damaging Het
Olfr750 T A 14: 51,071,157 I79F probably damaging Het
Olfr854 A T 9: 19,566,949 I145N probably benign Het
Osgepl1 T C 1: 53,321,096 V327A probably damaging Het
Pcdhb21 T C 18: 37,516,032 V738A possibly damaging Het
Plekha8 A T 6: 54,622,107 probably benign Het
Ptprq A C 10: 107,538,920 probably benign Het
Pus10 T A 11: 23,711,201 F263Y probably benign Het
Rad54b A T 4: 11,599,809 I338F probably damaging Het
Rad54l2 A G 9: 106,708,299 F756L probably damaging Het
Scn11a A G 9: 119,790,119 L719P probably damaging Het
Slc2a2 G A 3: 28,718,816 V253I possibly damaging Het
Slc39a4 A T 15: 76,615,138 N192K probably benign Het
Soat1 T A 1: 156,441,246 I245F probably damaging Het
Sorcs2 G A 5: 36,031,190 A858V probably benign Het
Tcim T C 8: 24,438,635 T88A possibly damaging Het
Tecta G A 9: 42,347,892 probably benign Het
Tgm5 C A 2: 121,048,895 L553F probably damaging Het
Tjp1 A G 7: 65,302,921 V1555A probably benign Het
Tmem214 A C 5: 30,869,668 M1L probably null Het
Togaram1 T C 12: 64,966,002 probably benign Het
Topaz1 C A 9: 122,749,479 L485I possibly damaging Het
Ttn T C 2: 76,718,282 probably benign Het
Ube2o A G 11: 116,546,459 probably null Het
Ubr7 T A 12: 102,768,206 D246E probably benign Het
Vcpkmt T C 12: 69,582,328 D132G probably benign Het
Vmn2r111 T A 17: 22,573,121 Q51H probably benign Het
Vmn2r95 C T 17: 18,439,503 P170S probably damaging Het
Zbtb38 A G 9: 96,685,773 I1086T probably damaging Het
Zfp444 G A 7: 6,188,173 A118T probably benign Het
Zp2 A G 7: 120,138,149 I272T probably damaging Het
Other mutations in Clip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Clip2 APN 5 134500157 splice site probably benign
IGL01024:Clip2 APN 5 134510212 missense probably damaging 1.00
IGL01103:Clip2 APN 5 134492350 missense possibly damaging 0.64
IGL01726:Clip2 APN 5 134522664 missense probably damaging 1.00
IGL01833:Clip2 APN 5 134498084 splice site probably benign
IGL02174:Clip2 APN 5 134494264 missense probably damaging 1.00
IGL02232:Clip2 APN 5 134503130 missense probably damaging 1.00
IGL02271:Clip2 APN 5 134502571 missense probably benign 0.35
IGL02471:Clip2 APN 5 134518022 missense probably benign 0.04
IGL02690:Clip2 APN 5 134510159 splice site probably benign
IGL03198:Clip2 APN 5 134498082 splice site probably benign
IGL03269:Clip2 APN 5 134516894 missense probably damaging 1.00
scissors UTSW 5 134517999 nonsense probably null
R0335:Clip2 UTSW 5 134535215 start gained probably benign
R0422:Clip2 UTSW 5 134498113 missense probably benign 0.04
R1169:Clip2 UTSW 5 134492250 missense probably benign 0.36
R1642:Clip2 UTSW 5 134503253 missense possibly damaging 0.89
R1718:Clip2 UTSW 5 134502929 nonsense probably null
R1822:Clip2 UTSW 5 134503227 missense probably benign 0.01
R1824:Clip2 UTSW 5 134503227 missense probably benign 0.01
R2011:Clip2 UTSW 5 134503115 missense probably damaging 1.00
R3106:Clip2 UTSW 5 134523064 missense probably benign 0.12
R3890:Clip2 UTSW 5 134522993 missense probably damaging 1.00
R3891:Clip2 UTSW 5 134522993 missense probably damaging 1.00
R3892:Clip2 UTSW 5 134522993 missense probably damaging 1.00
R4134:Clip2 UTSW 5 134492253 missense probably benign 0.08
R4237:Clip2 UTSW 5 134535197 start gained probably benign
R4239:Clip2 UTSW 5 134535197 start gained probably benign
R4294:Clip2 UTSW 5 134492313 missense probably benign 0.09
R4450:Clip2 UTSW 5 134502953 missense possibly damaging 0.82
R4741:Clip2 UTSW 5 134516269 missense probably benign 0.02
R5186:Clip2 UTSW 5 134522791 missense possibly damaging 0.46
R5235:Clip2 UTSW 5 134522791 missense possibly damaging 0.46
R5409:Clip2 UTSW 5 134522791 missense possibly damaging 0.46
R5410:Clip2 UTSW 5 134522791 missense possibly damaging 0.46
R5448:Clip2 UTSW 5 134514048 missense probably benign 0.01
R5900:Clip2 UTSW 5 134502779 missense possibly damaging 0.48
R6464:Clip2 UTSW 5 134491925 missense probably benign 0.00
R7032:Clip2 UTSW 5 134522630 missense probably damaging 1.00
R7152:Clip2 UTSW 5 134496241 missense probably damaging 1.00
R7216:Clip2 UTSW 5 134502917 missense probably benign 0.01
R7358:Clip2 UTSW 5 134502630 nonsense probably null
R7725:Clip2 UTSW 5 134517999 nonsense probably null
R8380:Clip2 UTSW 5 134502797 missense probably damaging 0.96
X0062:Clip2 UTSW 5 134503136 missense probably benign 0.12
Z1177:Clip2 UTSW 5 134516835 missense probably damaging 0.98
Z1177:Clip2 UTSW 5 134522999 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAGGAATCCTCTCTTGGAGTCTTGG -3'
(R):5'- AGTATCTTGAGTCTCGCCCATGCC -3'

Sequencing Primer
(F):5'- cctagaaattgacaaggctcac -3'
(R):5'- GCCCATGCCCACTCTCTG -3'
Posted On2013-06-12