Incidental Mutation 'R6045:Poli'
ID483820
Institutional Source Beutler Lab
Gene Symbol Poli
Ensembl Gene ENSMUSG00000038425
Gene Namepolymerase (DNA directed), iota
SynonymsRad30b
MMRRC Submission 044213-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6045 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location70508680-70530620 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70517469 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 363 (R363K)
Ref Sequence ENSEMBL: ENSMUSP00000112563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043286] [ENSMUST00000121674] [ENSMUST00000159389] [ENSMUST00000160713] [ENSMUST00000161542]
Predicted Effect possibly damaging
Transcript: ENSMUST00000043286
AA Change: R300K

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000039869
Gene: ENSMUSG00000038425
AA Change: R300K

DomainStartEndE-ValueType
Pfam:IMS 1 168 5.4e-39 PFAM
Pfam:IMS_HHH 180 212 1.2e-9 PFAM
Pfam:IMS_C 247 379 1.7e-12 PFAM
PDB:2KWV|A 444 489 8e-23 PDB
low complexity region 532 546 N/A INTRINSIC
PDB:3AI4|A 623 674 4e-26 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000121674
AA Change: R363K

PolyPhen 2 Score 0.751 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112563
Gene: ENSMUSG00000038425
AA Change: R363K

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:IMS 53 231 1e-47 PFAM
Pfam:IMS_HHH 243 275 1.5e-9 PFAM
Pfam:IMS_C 312 441 2.5e-14 PFAM
PDB:2KWV|A 507 552 8e-23 PDB
low complexity region 595 609 N/A INTRINSIC
PDB:3AI4|A 686 737 5e-26 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000159389
AA Change: R277K

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123964
Gene: ENSMUSG00000038425
AA Change: R277K

DomainStartEndE-ValueType
Pfam:IMS 1 145 1.8e-29 PFAM
Pfam:IMS_HHH 157 189 1.7e-9 PFAM
Pfam:IMS_C 224 356 2.4e-12 PFAM
PDB:2KWV|A 421 466 7e-23 PDB
low complexity region 509 523 N/A INTRINSIC
PDB:3AI4|A 600 651 3e-26 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160713
SMART Domains Protein: ENSMUSP00000125467
Gene: ENSMUSG00000038425

DomainStartEndE-ValueType
Pfam:IMS 1 127 5.9e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000161542
AA Change: R300K

PolyPhen 2 Score 0.513 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124877
Gene: ENSMUSG00000038425
AA Change: R300K

DomainStartEndE-ValueType
Pfam:IMS 1 168 5.4e-39 PFAM
Pfam:IMS_HHH 180 212 1.2e-9 PFAM
Pfam:IMS_C 247 379 1.7e-12 PFAM
PDB:2KWV|A 444 489 8e-23 PDB
low complexity region 532 546 N/A INTRINSIC
PDB:3AI4|A 623 674 4e-26 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184246
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a spontaneous mutation show normal somatic hypermutation of immunoglobulin variable genes and no significant increase in UV-induced epithelial skin tumor formation relative to controls; in contrast, formation of mesenchymal tumors by chronic UV irradiation is enhanced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik T C 8: 79,229,367 Y87C probably benign Het
5530401A14Rik A G 11: 81,893,868 probably benign Het
5830473C10Rik A T 5: 90,584,989 Q553L possibly damaging Het
Adamts5 T C 16: 85,899,300 D323G probably damaging Het
Bicc1 G A 10: 70,957,081 R248* probably null Het
Bivm T G 1: 44,119,073 probably benign Het
Ccdc8 A C 7: 16,996,031 T482P unknown Het
Ccnb2 T C 9: 70,419,093 I21V probably benign Het
Cfap73 A T 5: 120,631,712 I82N probably damaging Het
Chd3 A C 11: 69,352,118 F1426V possibly damaging Het
Clcn2 A T 16: 20,711,688 probably null Het
Col6a5 T C 9: 105,925,918 N1283D unknown Het
Cyp39a1 G T 17: 43,731,991 G411W probably damaging Het
D130052B06Rik A T 11: 33,624,008 I202L unknown Het
Dlgap1 T C 17: 70,818,098 L948P probably damaging Het
Dnah3 C T 7: 119,967,522 V2494M probably damaging Het
Dysf T A 6: 84,114,072 V1076D probably damaging Het
Eif2ak4 C A 2: 118,388,815 S36* probably null Het
Elmod3 C T 6: 72,568,868 R297H probably benign Het
Epas1 C A 17: 86,809,399 R166S probably damaging Het
Erv3 A G 2: 131,856,022 L139P probably damaging Het
Fryl A G 5: 73,118,551 V90A probably damaging Het
Fxr2 A G 11: 69,651,051 R439G possibly damaging Het
Gabrd A T 4: 155,386,474 V259D possibly damaging Het
Galnt10 A G 11: 57,783,793 Y536C probably damaging Het
Gbp10 A T 5: 105,218,403 L545Q probably damaging Het
Gfpt1 A T 6: 87,085,257 I517F probably damaging Het
Glb1 T C 9: 114,437,942 Y225H probably damaging Het
Gm1110 C T 9: 26,883,209 probably null Het
Gm14851 A T 8: 21,095,232 C65S possibly damaging Het
Gm36028 G T 16: 37,856,022 Q128K probably benign Het
Gmps C T 3: 63,980,137 P10L probably benign Het
Greb1l T A 18: 10,547,068 V1465D probably damaging Het
Helz2 A G 2: 181,240,313 V229A probably benign Het
Hipk1 A T 3: 103,746,902 L924Q probably benign Het
Ifngr1 T G 10: 19,609,161 L303V possibly damaging Het
Kif22 T C 7: 127,031,078 N429D probably benign Het
Ktn1 T C 14: 47,676,796 Y401H probably damaging Het
Lars2 T G 9: 123,371,988 I39S probably damaging Het
Lipf C T 19: 33,966,844 A151V probably damaging Het
Lrp1 A T 10: 127,566,600 M2234K probably damaging Het
Lrp1b A G 2: 40,701,813 V56A unknown Het
Lyar T A 5: 38,234,008 H350Q probably benign Het
Mill2 A T 7: 18,856,564 M190L probably benign Het
Morc3 A G 16: 93,874,845 D921G probably damaging Het
Mpp2 G T 11: 102,059,354 T558K probably benign Het
Myh4 A G 11: 67,244,724 D379G probably benign Het
Neb A C 2: 52,194,425 probably null Het
Nedd1 G A 10: 92,695,100 R376* probably null Het
Nlrc4 T G 17: 74,446,959 D143A probably damaging Het
Nol10 G T 12: 17,348,478 probably benign Het
Olfr1316 T G 2: 112,130,536 I92L possibly damaging Het
Olfr1404 C T 1: 173,216,500 T283I possibly damaging Het
Olfr1431 C A 19: 12,210,295 A243D probably damaging Het
Olfr197 T A 16: 59,186,091 T131S probably benign Het
Olfr652 C T 7: 104,564,767 T182I probably benign Het
Opn1sw A G 6: 29,379,870 S122P probably damaging Het
Orm1 T A 4: 63,344,692 I32N possibly damaging Het
Pcdhb5 T A 18: 37,321,575 V336E probably damaging Het
Rabgap1l T C 1: 160,645,323 E515G probably benign Het
Rem2 C A 14: 54,477,768 T134N probably damaging Het
Rfc1 A G 5: 65,279,549 I596T probably damaging Het
Ruvbl2 A T 7: 45,425,009 I202N probably damaging Het
S100a6 T A 3: 90,613,879 I38N probably damaging Het
Scel T C 14: 103,592,213 C435R probably benign Het
Slc6a13 T A 6: 121,321,628 W146R probably damaging Het
Sorcs1 T A 19: 50,190,117 K856* probably null Het
Speer4e T G 5: 14,937,181 K70T possibly damaging Het
Sucla2 T A 14: 73,568,964 C158* probably null Het
Tie1 G A 4: 118,484,691 S187L probably benign Het
Tmem200a T C 10: 25,993,007 T455A probably damaging Het
Tra2a A G 6: 49,252,464 probably benign Het
Tsnaxip1 A C 8: 105,844,187 E615A probably benign Het
Tuba3b T A 6: 145,621,174 N380K probably damaging Het
Umod C T 7: 119,476,823 S240N probably benign Het
Vmn2r92 G A 17: 18,168,043 probably null Het
Vps13b A G 15: 35,671,316 E1655G probably damaging Het
Vwde A T 6: 13,219,936 I72N probably damaging Het
Wbp11 G A 6: 136,821,535 A172V probably damaging Het
Zbtb41 T A 1: 139,424,032 N294K probably benign Het
Zfhx4 T A 3: 5,396,959 H1206Q probably damaging Het
Other mutations in Poli
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Poli APN 18 70525490 missense probably damaging 1.00
IGL01506:Poli APN 18 70509731 missense probably benign
IGL01958:Poli APN 18 70526586 missense possibly damaging 0.46
IGL02375:Poli APN 18 70523292 missense probably damaging 1.00
IGL02385:Poli APN 18 70526574 missense possibly damaging 0.93
IGL02480:Poli APN 18 70525406 missense probably benign 0.04
R0113:Poli UTSW 18 70528758 missense probably damaging 1.00
R0184:Poli UTSW 18 70522731 missense probably damaging 1.00
R0348:Poli UTSW 18 70523381 missense probably benign 0.00
R0710:Poli UTSW 18 70522890 splice site probably null
R1004:Poli UTSW 18 70525438 missense probably benign 0.31
R1264:Poli UTSW 18 70517503 missense probably benign 0.05
R1660:Poli UTSW 18 70509464 missense probably damaging 0.99
R1992:Poli UTSW 18 70508987 missense probably damaging 0.98
R2915:Poli UTSW 18 70522700 critical splice donor site probably null
R4531:Poli UTSW 18 70517477 missense probably benign 0.41
R4816:Poli UTSW 18 70522751 missense probably damaging 1.00
R5393:Poli UTSW 18 70517428 nonsense probably null
R5404:Poli UTSW 18 70509432 missense probably benign 0.15
R5559:Poli UTSW 18 70509285 missense probably benign 0.02
R5957:Poli UTSW 18 70517440 missense probably benign
R6385:Poli UTSW 18 70530001 start gained probably benign
R6807:Poli UTSW 18 70530151 intron probably null
R7024:Poli UTSW 18 70516849 missense possibly damaging 0.68
R7067:Poli UTSW 18 70509417 nonsense probably null
R7452:Poli UTSW 18 70508978 missense possibly damaging 0.94
R7653:Poli UTSW 18 70509627 missense probably benign
R7685:Poli UTSW 18 70525519 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AAACACTTTAATGTGGCATGTTTC -3'
(R):5'- TGCTTAATATTGTGTCACAAGTCAA -3'

Posted On2017-07-14