Incidental Mutation 'R6045:Sorcs1'
ID483823
Institutional Source Beutler Lab
Gene Symbol Sorcs1
Ensembl Gene ENSMUSG00000043531
Gene Namesortilin-related VPS10 domain containing receptor 1
Synonyms
MMRRC Submission 044213-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R6045 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location50143299-50678646 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 50190117 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 856 (K856*)
Ref Sequence ENSEMBL: ENSMUSP00000147591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]
Predicted Effect probably null
Transcript: ENSMUST00000072685
AA Change: K856*
SMART Domains Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531
AA Change: K856*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111756
AA Change: K856*
SMART Domains Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531
AA Change: K856*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164039
AA Change: K856*
SMART Domains Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531
AA Change: K856*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
low complexity region 1129 1142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168357
SMART Domains Protein: ENSMUSP00000129190
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
VPS10 1 320 6.99e-58 SMART
PKD 322 412 3.84e-1 SMART
PKD 420 498 8.63e-1 SMART
transmembrane domain 621 643 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000209413
AA Change: K856*
Predicted Effect probably null
Transcript: ENSMUST00000209783
AA Change: K856*
Predicted Effect probably null
Transcript: ENSMUST00000211008
AA Change: K856*
Predicted Effect probably null
Transcript: ENSMUST00000211687
AA Change: K856*
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011L22Rik T C 8: 79,229,367 Y87C probably benign Het
5530401A14Rik A G 11: 81,893,868 probably benign Het
5830473C10Rik A T 5: 90,584,989 Q553L possibly damaging Het
Adamts5 T C 16: 85,899,300 D323G probably damaging Het
Bicc1 G A 10: 70,957,081 R248* probably null Het
Bivm T G 1: 44,119,073 probably benign Het
Ccdc8 A C 7: 16,996,031 T482P unknown Het
Ccnb2 T C 9: 70,419,093 I21V probably benign Het
Cfap73 A T 5: 120,631,712 I82N probably damaging Het
Chd3 A C 11: 69,352,118 F1426V possibly damaging Het
Clcn2 A T 16: 20,711,688 probably null Het
Col6a5 T C 9: 105,925,918 N1283D unknown Het
Cyp39a1 G T 17: 43,731,991 G411W probably damaging Het
D130052B06Rik A T 11: 33,624,008 I202L unknown Het
Dlgap1 T C 17: 70,818,098 L948P probably damaging Het
Dnah3 C T 7: 119,967,522 V2494M probably damaging Het
Dysf T A 6: 84,114,072 V1076D probably damaging Het
Eif2ak4 C A 2: 118,388,815 S36* probably null Het
Elmod3 C T 6: 72,568,868 R297H probably benign Het
Epas1 C A 17: 86,809,399 R166S probably damaging Het
Erv3 A G 2: 131,856,022 L139P probably damaging Het
Fryl A G 5: 73,118,551 V90A probably damaging Het
Fxr2 A G 11: 69,651,051 R439G possibly damaging Het
Gabrd A T 4: 155,386,474 V259D possibly damaging Het
Galnt10 A G 11: 57,783,793 Y536C probably damaging Het
Gbp10 A T 5: 105,218,403 L545Q probably damaging Het
Gfpt1 A T 6: 87,085,257 I517F probably damaging Het
Glb1 T C 9: 114,437,942 Y225H probably damaging Het
Gm1110 C T 9: 26,883,209 probably null Het
Gm14851 A T 8: 21,095,232 C65S possibly damaging Het
Gm36028 G T 16: 37,856,022 Q128K probably benign Het
Gmps C T 3: 63,980,137 P10L probably benign Het
Greb1l T A 18: 10,547,068 V1465D probably damaging Het
Helz2 A G 2: 181,240,313 V229A probably benign Het
Hipk1 A T 3: 103,746,902 L924Q probably benign Het
Ifngr1 T G 10: 19,609,161 L303V possibly damaging Het
Kif22 T C 7: 127,031,078 N429D probably benign Het
Ktn1 T C 14: 47,676,796 Y401H probably damaging Het
Lars2 T G 9: 123,371,988 I39S probably damaging Het
Lipf C T 19: 33,966,844 A151V probably damaging Het
Lrp1 A T 10: 127,566,600 M2234K probably damaging Het
Lrp1b A G 2: 40,701,813 V56A unknown Het
Lyar T A 5: 38,234,008 H350Q probably benign Het
Mill2 A T 7: 18,856,564 M190L probably benign Het
Morc3 A G 16: 93,874,845 D921G probably damaging Het
Mpp2 G T 11: 102,059,354 T558K probably benign Het
Myh4 A G 11: 67,244,724 D379G probably benign Het
Neb A C 2: 52,194,425 probably null Het
Nedd1 G A 10: 92,695,100 R376* probably null Het
Nlrc4 T G 17: 74,446,959 D143A probably damaging Het
Nol10 G T 12: 17,348,478 probably benign Het
Olfr1316 T G 2: 112,130,536 I92L possibly damaging Het
Olfr1404 C T 1: 173,216,500 T283I possibly damaging Het
Olfr1431 C A 19: 12,210,295 A243D probably damaging Het
Olfr197 T A 16: 59,186,091 T131S probably benign Het
Olfr652 C T 7: 104,564,767 T182I probably benign Het
Opn1sw A G 6: 29,379,870 S122P probably damaging Het
Orm1 T A 4: 63,344,692 I32N possibly damaging Het
Pcdhb5 T A 18: 37,321,575 V336E probably damaging Het
Poli C T 18: 70,517,469 R363K possibly damaging Het
Rabgap1l T C 1: 160,645,323 E515G probably benign Het
Rem2 C A 14: 54,477,768 T134N probably damaging Het
Rfc1 A G 5: 65,279,549 I596T probably damaging Het
Ruvbl2 A T 7: 45,425,009 I202N probably damaging Het
S100a6 T A 3: 90,613,879 I38N probably damaging Het
Scel T C 14: 103,592,213 C435R probably benign Het
Slc6a13 T A 6: 121,321,628 W146R probably damaging Het
Speer4e T G 5: 14,937,181 K70T possibly damaging Het
Sucla2 T A 14: 73,568,964 C158* probably null Het
Tie1 G A 4: 118,484,691 S187L probably benign Het
Tmem200a T C 10: 25,993,007 T455A probably damaging Het
Tra2a A G 6: 49,252,464 probably benign Het
Tsnaxip1 A C 8: 105,844,187 E615A probably benign Het
Tuba3b T A 6: 145,621,174 N380K probably damaging Het
Umod C T 7: 119,476,823 S240N probably benign Het
Vmn2r92 G A 17: 18,168,043 probably null Het
Vps13b A G 15: 35,671,316 E1655G probably damaging Het
Vwde A T 6: 13,219,936 I72N probably damaging Het
Wbp11 G A 6: 136,821,535 A172V probably damaging Het
Zbtb41 T A 1: 139,424,032 N294K probably benign Het
Zfhx4 T A 3: 5,396,959 H1206Q probably damaging Het
Other mutations in Sorcs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sorcs1 APN 19 50190054 missense probably damaging 1.00
IGL00983:Sorcs1 APN 19 50176128 missense probably damaging 0.98
IGL01125:Sorcs1 APN 19 50228201 missense probably damaging 1.00
IGL01320:Sorcs1 APN 19 50288079 splice site probably benign
IGL01445:Sorcs1 APN 19 50153066 missense probably damaging 1.00
IGL01682:Sorcs1 APN 19 50181506 missense probably benign 0.43
IGL01799:Sorcs1 APN 19 50230209 critical splice donor site probably null
IGL02044:Sorcs1 APN 19 50288159 splice site probably benign
IGL02111:Sorcs1 APN 19 50230245 missense probably benign 0.00
IGL02364:Sorcs1 APN 19 50333598 missense probably damaging 1.00
IGL02378:Sorcs1 APN 19 50182671 nonsense probably null
IGL02498:Sorcs1 APN 19 50678168 missense probably benign
IGL02658:Sorcs1 APN 19 50190092 missense probably damaging 1.00
IGL02939:Sorcs1 APN 19 50677930 nonsense probably null
IGL02942:Sorcs1 APN 19 50475437 missense probably damaging 1.00
IGL03057:Sorcs1 APN 19 50259756 nonsense probably null
IGL03230:Sorcs1 APN 19 50242093 missense probably damaging 1.00
P0033:Sorcs1 UTSW 19 50152907 missense probably damaging 0.98
R0109:Sorcs1 UTSW 19 50378891 splice site probably benign
R0115:Sorcs1 UTSW 19 50636453 intron probably benign
R0242:Sorcs1 UTSW 19 50228221 missense probably damaging 1.00
R0242:Sorcs1 UTSW 19 50228221 missense probably damaging 1.00
R0325:Sorcs1 UTSW 19 50313042 splice site probably null
R0481:Sorcs1 UTSW 19 50636453 intron probably benign
R0581:Sorcs1 UTSW 19 50252701 missense possibly damaging 0.70
R0669:Sorcs1 UTSW 19 50241942 splice site probably benign
R0980:Sorcs1 UTSW 19 50232323 missense probably benign 0.04
R1158:Sorcs1 UTSW 19 50144160 unclassified probably benign
R1519:Sorcs1 UTSW 19 50252587 missense probably benign 0.05
R1669:Sorcs1 UTSW 19 50475422 missense probably damaging 0.99
R1779:Sorcs1 UTSW 19 50175043 splice site probably benign
R1783:Sorcs1 UTSW 19 50228309 critical splice acceptor site probably null
R1927:Sorcs1 UTSW 19 50222195 missense probably damaging 1.00
R1935:Sorcs1 UTSW 19 50232644 missense probably damaging 0.96
R1936:Sorcs1 UTSW 19 50232644 missense probably damaging 0.96
R2109:Sorcs1 UTSW 19 50678192 missense probably benign
R2206:Sorcs1 UTSW 19 50230217 missense possibly damaging 0.81
R2207:Sorcs1 UTSW 19 50230217 missense possibly damaging 0.81
R3031:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3032:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3107:Sorcs1 UTSW 19 50210650 missense possibly damaging 0.83
R3508:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3738:Sorcs1 UTSW 19 50151221 missense probably benign 0.03
R4127:Sorcs1 UTSW 19 50222159 missense probably benign 0.29
R4212:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R4213:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R4385:Sorcs1 UTSW 19 50190161 missense probably benign 0.01
R4424:Sorcs1 UTSW 19 50378941 missense probably damaging 0.97
R4603:Sorcs1 UTSW 19 50312964 critical splice donor site probably null
R4679:Sorcs1 UTSW 19 50182669 missense probably benign
R4780:Sorcs1 UTSW 19 50143981 unclassified probably benign
R4781:Sorcs1 UTSW 19 50182681 missense probably damaging 1.00
R4823:Sorcs1 UTSW 19 50678140 missense possibly damaging 0.92
R4823:Sorcs1 UTSW 19 50230302 missense possibly damaging 0.87
R4883:Sorcs1 UTSW 19 50232303 missense probably benign 0.00
R5091:Sorcs1 UTSW 19 50259752 critical splice donor site probably null
R5105:Sorcs1 UTSW 19 50225141 missense possibly damaging 0.57
R5437:Sorcs1 UTSW 19 50252602 missense probably benign 0.19
R5574:Sorcs1 UTSW 19 50222133 missense probably damaging 1.00
R5734:Sorcs1 UTSW 19 50182775 missense probably benign 0.04
R6091:Sorcs1 UTSW 19 50288101 missense possibly damaging 0.64
R6119:Sorcs1 UTSW 19 50288094 missense probably damaging 0.98
R6226:Sorcs1 UTSW 19 50181414 missense probably damaging 1.00
R6337:Sorcs1 UTSW 19 50144124 missense probably benign 0.00
R6378:Sorcs1 UTSW 19 50225177 missense possibly damaging 0.57
R6782:Sorcs1 UTSW 19 50176122 nonsense probably null
R6792:Sorcs1 UTSW 19 50678168 missense probably benign
R6891:Sorcs1 UTSW 19 50225119 nonsense probably null
R7151:Sorcs1 UTSW 19 50312982 missense probably damaging 1.00
R7223:Sorcs1 UTSW 19 50190042 missense probably benign 0.06
R7356:Sorcs1 UTSW 19 50175157 missense possibly damaging 0.86
R7471:Sorcs1 UTSW 19 50262263 missense probably damaging 1.00
R7474:Sorcs1 UTSW 19 50153112 missense possibly damaging 0.65
R7503:Sorcs1 UTSW 19 50153052 missense probably benign
R7506:Sorcs1 UTSW 19 50182674 nonsense probably null
R7573:Sorcs1 UTSW 19 50152796 nonsense probably null
R7867:Sorcs1 UTSW 19 50230260 nonsense probably null
R7911:Sorcs1 UTSW 19 50144032 missense unknown
R7950:Sorcs1 UTSW 19 50230260 nonsense probably null
R7992:Sorcs1 UTSW 19 50144032 missense unknown
R8032:Sorcs1 UTSW 19 50475408 missense probably benign 0.28
R8063:Sorcs1 UTSW 19 50143977 missense unknown
X0024:Sorcs1 UTSW 19 50182763 missense possibly damaging 0.92
Z1088:Sorcs1 UTSW 19 50222143 missense probably benign 0.16
Z1177:Sorcs1 UTSW 19 50226742 missense probably null 1.00
Z1177:Sorcs1 UTSW 19 50333599 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTCTAGACAGAGCAATCAACATTG -3'
(R):5'- GATGCGAGTTTGCCTTAGATAG -3'

Posted On2017-07-14