Incidental Mutation 'R6062:Tenm3'
ID 483846
Institutional Source Beutler Lab
Gene Symbol Tenm3
Ensembl Gene ENSMUSG00000031561
Gene Name teneurin transmembrane protein 3
Synonyms Odz3, Ten-m3, 2610100B16Rik
MMRRC Submission 044227-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.584) question?
Stock # R6062 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 48680717-49296986 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 48796441 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 455 (I455L)
Ref Sequence ENSEMBL: ENSMUSP00000140141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000110346] [ENSMUST00000190840]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000033965
AA Change: I455L

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561
AA Change: I455L

DomainStartEndE-ValueType
Pfam:Ten_N 11 177 6.9e-91 PFAM
Pfam:Ten_N 171 308 1e-72 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2631 2708 1.5e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110346
AA Change: I183L

PolyPhen 2 Score 0.383 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000105975
Gene: ENSMUSG00000031561
AA Change: I183L

DomainStartEndE-ValueType
Pfam:Ten_N 1 36 1.1e-14 PFAM
transmembrane domain 37 59 N/A INTRINSIC
EGF 245 273 2.32e-1 SMART
EGF_like 276 304 4.11e1 SMART
EGF 309 338 1.69e1 SMART
EGF 341 370 1.35e-2 SMART
EGF 375 405 6.11e-1 SMART
EGF 408 436 7.95e0 SMART
EGF 439 467 1.28e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000190840
AA Change: I455L

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561
AA Change: I455L

DomainStartEndE-ValueType
Pfam:Ten_N 10 182 7.6e-77 PFAM
Pfam:Ten_N 168 308 6.6e-50 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2630 2708 3.2e-35 PFAM
Meta Mutation Damage Score 0.0868 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atat1 T A 17: 36,219,456 (GRCm39) Q136L probably damaging Het
Atm A G 9: 53,399,887 (GRCm39) L1531P probably damaging Het
Brca2 G A 5: 150,480,354 (GRCm39) R2708H probably damaging Het
Cand1 G A 10: 119,053,915 (GRCm39) A141V possibly damaging Het
Cdcp2 T C 4: 106,959,689 (GRCm39) S35P probably damaging Het
Ces4a G A 8: 105,864,806 (GRCm39) probably null Het
Colec10 T A 15: 54,323,203 (GRCm39) M142K possibly damaging Het
Crtc1 G T 8: 70,858,839 (GRCm39) D90E probably damaging Het
Csmd1 T C 8: 16,142,319 (GRCm39) E1528G possibly damaging Het
Csnk2a2 A G 8: 96,184,097 (GRCm39) V154A possibly damaging Het
Daglb T C 5: 143,480,358 (GRCm39) I454T probably benign Het
Dtna C A 18: 23,755,113 (GRCm39) N478K possibly damaging Het
E330034G19Rik A T 14: 24,343,448 (GRCm39) probably benign Het
Ecpas G T 4: 58,826,453 (GRCm39) S1038Y possibly damaging Het
Eefsec A T 6: 88,332,611 (GRCm39) S200T probably benign Het
Enthd1 T A 15: 80,336,916 (GRCm39) D506V probably damaging Het
Erbb2 A G 11: 98,324,075 (GRCm39) Y736C probably damaging Het
Gabrg1 A G 5: 70,938,056 (GRCm39) C183R probably damaging Het
Ginm1 T A 10: 7,651,097 (GRCm39) H103L probably benign Het
Golgb1 C A 16: 36,735,033 (GRCm39) Q1427K possibly damaging Het
Grb14 G T 2: 64,852,964 (GRCm39) Q9K possibly damaging Het
Hbp1 A T 12: 31,987,246 (GRCm39) M192K probably damaging Het
Herpud2 A T 9: 25,020,284 (GRCm39) D357E probably damaging Het
Idi1 A G 13: 8,937,541 (GRCm39) S111G probably damaging Het
Lrrc32 T C 7: 98,147,748 (GRCm39) V176A probably benign Het
Matn1 T A 4: 130,679,277 (GRCm39) D310E probably benign Het
Mbtps1 A T 8: 120,257,830 (GRCm39) L469Q possibly damaging Het
Muc4 A G 16: 32,579,682 (GRCm39) D2417G unknown Het
Myo7b T C 18: 32,101,043 (GRCm39) T1551A possibly damaging Het
Neb A G 2: 52,075,293 (GRCm39) M224T probably benign Het
Ola1 A T 2: 73,029,842 (GRCm39) D92E probably damaging Het
Or1e28-ps1 A C 11: 73,615,386 (GRCm39) C155G unknown Het
Or4l1 A T 14: 50,166,119 (GRCm39) M294K probably damaging Het
Or5ar1 T G 2: 85,671,458 (GRCm39) I226L probably benign Het
Or8b48 T A 9: 38,450,440 (GRCm39) M83K probably damaging Het
Otud4 T C 8: 80,400,525 (GRCm39) Y1080H probably damaging Het
Plce1 G A 19: 38,513,195 (GRCm39) A165T probably benign Het
Prelid2 T C 18: 42,045,530 (GRCm39) I127V probably benign Het
Rab35 A G 5: 115,778,147 (GRCm39) I38V probably damaging Het
Rab3d T C 9: 21,821,815 (GRCm39) T209A probably benign Het
Rapgef1 A G 2: 29,590,744 (GRCm39) E321G probably damaging Het
Rem1 T C 2: 152,470,017 (GRCm39) M1T probably null Het
Rgsl1 T C 1: 153,675,618 (GRCm39) K181R possibly damaging Het
Scel C A 14: 103,822,572 (GRCm39) N395K possibly damaging Het
Septin9 A G 11: 117,181,626 (GRCm39) E142G possibly damaging Het
Shcbp1 A C 8: 4,814,905 (GRCm39) M191R probably benign Het
Slc22a19 T C 19: 7,651,647 (GRCm39) N520S probably damaging Het
Slc28a1 C T 7: 80,765,311 (GRCm39) R9* probably null Het
Slc2a7 T C 4: 150,252,884 (GRCm39) V508A probably benign Het
Slc8a3 G A 12: 81,361,124 (GRCm39) P565L probably damaging Het
Svil T G 18: 5,106,724 (GRCm39) V1855G probably damaging Het
Tmem267 T C 13: 120,070,767 (GRCm39) S141P probably damaging Het
Tnn T A 1: 159,925,848 (GRCm39) D1383V probably damaging Het
Usp9y G T Y: 1,454,199 (GRCm39) Q23K probably benign Het
Vmn1r46 T C 6: 89,953,241 (GRCm39) I30T possibly damaging Het
Zfp382 T C 7: 29,833,015 (GRCm39) L222P probably damaging Het
Zfp950 T A 19: 61,108,863 (GRCm39) K73N possibly damaging Het
Other mutations in Tenm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Tenm3 APN 8 48,870,095 (GRCm39) missense probably damaging 1.00
IGL00538:Tenm3 APN 8 48,689,060 (GRCm39) missense probably damaging 1.00
IGL00719:Tenm3 APN 8 48,732,077 (GRCm39) missense probably benign 0.39
IGL00720:Tenm3 APN 8 48,729,456 (GRCm39) missense probably damaging 0.98
IGL00870:Tenm3 APN 8 48,870,167 (GRCm39) missense probably benign 0.00
IGL00976:Tenm3 APN 8 48,709,876 (GRCm39) missense probably benign 0.14
IGL01469:Tenm3 APN 8 48,689,458 (GRCm39) missense probably damaging 1.00
IGL01508:Tenm3 APN 8 48,729,680 (GRCm39) missense probably benign 0.09
IGL01590:Tenm3 APN 8 48,681,837 (GRCm39) missense probably damaging 1.00
IGL01610:Tenm3 APN 8 48,707,512 (GRCm39) missense probably damaging 1.00
IGL01874:Tenm3 APN 8 48,689,793 (GRCm39) nonsense probably null
IGL01892:Tenm3 APN 8 48,729,431 (GRCm39) missense probably benign 0.09
IGL02098:Tenm3 APN 8 48,729,611 (GRCm39) missense possibly damaging 0.94
IGL02382:Tenm3 APN 8 48,688,511 (GRCm39) missense probably damaging 1.00
IGL02397:Tenm3 APN 8 48,689,729 (GRCm39) missense possibly damaging 0.94
IGL02475:Tenm3 APN 8 48,732,233 (GRCm39) splice site probably benign
IGL02502:Tenm3 APN 8 48,741,051 (GRCm39) missense probably damaging 1.00
IGL02508:Tenm3 APN 8 48,752,674 (GRCm39) missense probably benign 0.30
IGL02543:Tenm3 APN 8 48,751,991 (GRCm39) missense probably damaging 1.00
IGL02723:Tenm3 APN 8 48,729,938 (GRCm39) missense probably benign 0.02
IGL03037:Tenm3 APN 8 48,751,913 (GRCm39) missense possibly damaging 0.90
IGL03160:Tenm3 APN 8 49,099,453 (GRCm39) missense probably benign 0.05
IGL03268:Tenm3 APN 8 48,688,558 (GRCm39) missense probably damaging 1.00
IGL02988:Tenm3 UTSW 8 48,688,381 (GRCm39) missense probably damaging 0.99
PIT4431001:Tenm3 UTSW 8 48,688,642 (GRCm39) missense probably damaging 1.00
PIT4504001:Tenm3 UTSW 8 48,746,692 (GRCm39) missense probably damaging 1.00
R0079:Tenm3 UTSW 8 48,796,380 (GRCm39) missense possibly damaging 0.90
R0121:Tenm3 UTSW 8 48,795,694 (GRCm39) missense probably damaging 0.99
R0123:Tenm3 UTSW 8 49,127,507 (GRCm39) missense probably damaging 1.00
R0134:Tenm3 UTSW 8 49,127,507 (GRCm39) missense probably damaging 1.00
R0147:Tenm3 UTSW 8 48,689,755 (GRCm39) missense probably damaging 1.00
R0148:Tenm3 UTSW 8 48,689,755 (GRCm39) missense probably damaging 1.00
R0309:Tenm3 UTSW 8 48,794,069 (GRCm39) missense probably damaging 1.00
R0322:Tenm3 UTSW 8 48,689,947 (GRCm39) splice site probably benign
R0335:Tenm3 UTSW 8 48,685,140 (GRCm39) missense probably damaging 1.00
R0355:Tenm3 UTSW 8 48,682,010 (GRCm39) missense probably damaging 1.00
R0411:Tenm3 UTSW 8 48,740,826 (GRCm39) missense possibly damaging 0.61
R0505:Tenm3 UTSW 8 48,794,195 (GRCm39) splice site probably benign
R0573:Tenm3 UTSW 8 49,127,434 (GRCm39) splice site probably benign
R0599:Tenm3 UTSW 8 48,730,745 (GRCm39) missense probably damaging 1.00
R0616:Tenm3 UTSW 8 48,729,191 (GRCm39) missense possibly damaging 0.76
R0637:Tenm3 UTSW 8 48,689,560 (GRCm39) missense probably damaging 1.00
R0726:Tenm3 UTSW 8 48,689,629 (GRCm39) missense probably damaging 1.00
R0840:Tenm3 UTSW 8 48,788,777 (GRCm39) missense probably damaging 0.99
R0981:Tenm3 UTSW 8 48,752,000 (GRCm39) missense probably damaging 1.00
R1006:Tenm3 UTSW 8 48,681,577 (GRCm39) missense probably damaging 1.00
R1199:Tenm3 UTSW 8 48,688,617 (GRCm39) missense probably damaging 0.99
R1223:Tenm3 UTSW 8 48,693,431 (GRCm39) missense possibly damaging 0.72
R1240:Tenm3 UTSW 8 48,740,928 (GRCm39) missense possibly damaging 0.74
R1394:Tenm3 UTSW 8 48,729,435 (GRCm39) missense probably benign
R1455:Tenm3 UTSW 8 48,732,083 (GRCm39) missense possibly damaging 0.87
R1459:Tenm3 UTSW 8 48,689,006 (GRCm39) missense probably damaging 1.00
R1473:Tenm3 UTSW 8 48,763,660 (GRCm39) missense probably damaging 1.00
R1501:Tenm3 UTSW 8 48,796,351 (GRCm39) missense probably damaging 0.99
R1507:Tenm3 UTSW 8 48,740,857 (GRCm39) missense probably benign 0.01
R1522:Tenm3 UTSW 8 48,848,611 (GRCm39) missense probably damaging 1.00
R1524:Tenm3 UTSW 8 48,682,016 (GRCm39) missense possibly damaging 0.92
R1553:Tenm3 UTSW 8 48,689,456 (GRCm39) missense probably damaging 1.00
R1572:Tenm3 UTSW 8 48,682,028 (GRCm39) missense possibly damaging 0.94
R1583:Tenm3 UTSW 8 48,732,109 (GRCm39) missense probably benign 0.09
R1676:Tenm3 UTSW 8 48,870,154 (GRCm39) missense possibly damaging 0.83
R1732:Tenm3 UTSW 8 48,763,669 (GRCm39) missense probably damaging 1.00
R1768:Tenm3 UTSW 8 48,685,139 (GRCm39) missense probably damaging 1.00
R1777:Tenm3 UTSW 8 48,870,214 (GRCm39) missense probably benign 0.05
R1793:Tenm3 UTSW 8 49,127,579 (GRCm39) missense probably damaging 0.98
R1801:Tenm3 UTSW 8 48,729,291 (GRCm39) missense probably benign 0.39
R1863:Tenm3 UTSW 8 48,729,381 (GRCm39) missense probably benign 0.20
R1898:Tenm3 UTSW 8 48,763,796 (GRCm39) missense probably damaging 1.00
R1971:Tenm3 UTSW 8 48,689,348 (GRCm39) missense probably damaging 1.00
R1972:Tenm3 UTSW 8 48,681,626 (GRCm39) missense probably damaging 1.00
R1996:Tenm3 UTSW 8 48,681,703 (GRCm39) missense probably damaging 1.00
R2061:Tenm3 UTSW 8 48,795,291 (GRCm39) critical splice donor site probably null
R2109:Tenm3 UTSW 8 48,796,384 (GRCm39) missense possibly damaging 0.94
R2124:Tenm3 UTSW 8 48,870,041 (GRCm39) critical splice donor site probably null
R2190:Tenm3 UTSW 8 48,848,579 (GRCm39) missense probably damaging 1.00
R2204:Tenm3 UTSW 8 49,127,585 (GRCm39) missense probably benign 0.17
R2233:Tenm3 UTSW 8 48,729,204 (GRCm39) missense probably benign 0.04
R2234:Tenm3 UTSW 8 48,729,204 (GRCm39) missense probably benign 0.04
R2235:Tenm3 UTSW 8 48,729,204 (GRCm39) missense probably benign 0.04
R2237:Tenm3 UTSW 8 48,795,372 (GRCm39) missense probably damaging 1.00
R2418:Tenm3 UTSW 8 48,729,693 (GRCm39) missense possibly damaging 0.87
R2419:Tenm3 UTSW 8 48,729,693 (GRCm39) missense possibly damaging 0.87
R2435:Tenm3 UTSW 8 48,740,988 (GRCm39) missense probably damaging 1.00
R2483:Tenm3 UTSW 8 48,693,305 (GRCm39) missense probably damaging 0.99
R3406:Tenm3 UTSW 8 48,681,590 (GRCm39) missense probably damaging 1.00
R3724:Tenm3 UTSW 8 48,730,781 (GRCm39) missense probably damaging 0.97
R4009:Tenm3 UTSW 8 48,802,258 (GRCm39) missense probably damaging 1.00
R4210:Tenm3 UTSW 8 48,802,439 (GRCm39) missense probably damaging 1.00
R4293:Tenm3 UTSW 8 48,848,693 (GRCm39) missense probably damaging 1.00
R4656:Tenm3 UTSW 8 48,746,761 (GRCm39) missense probably damaging 1.00
R4663:Tenm3 UTSW 8 48,689,005 (GRCm39) missense probably damaging 1.00
R4835:Tenm3 UTSW 8 48,766,271 (GRCm39) critical splice donor site probably null
R4851:Tenm3 UTSW 8 48,763,656 (GRCm39) critical splice donor site probably null
R4867:Tenm3 UTSW 8 48,688,856 (GRCm39) missense probably damaging 1.00
R4892:Tenm3 UTSW 8 48,729,896 (GRCm39) missense probably damaging 0.99
R4895:Tenm3 UTSW 8 48,754,006 (GRCm39) missense probably damaging 1.00
R4962:Tenm3 UTSW 8 48,731,996 (GRCm39) nonsense probably null
R4995:Tenm3 UTSW 8 48,682,172 (GRCm39) missense possibly damaging 0.87
R4996:Tenm3 UTSW 8 48,688,861 (GRCm39) missense probably damaging 0.97
R5091:Tenm3 UTSW 8 48,795,343 (GRCm39) missense probably benign 0.14
R5228:Tenm3 UTSW 8 48,689,390 (GRCm39) missense probably damaging 1.00
R5253:Tenm3 UTSW 8 48,682,233 (GRCm39) missense possibly damaging 0.92
R5260:Tenm3 UTSW 8 48,689,890 (GRCm39) missense probably damaging 1.00
R5363:Tenm3 UTSW 8 48,740,866 (GRCm39) missense possibly damaging 0.55
R5414:Tenm3 UTSW 8 48,689,390 (GRCm39) missense probably damaging 1.00
R5427:Tenm3 UTSW 8 48,689,599 (GRCm39) missense probably damaging 1.00
R5431:Tenm3 UTSW 8 48,820,412 (GRCm39) nonsense probably null
R5566:Tenm3 UTSW 8 48,732,041 (GRCm39) missense probably damaging 1.00
R5579:Tenm3 UTSW 8 48,689,799 (GRCm39) missense probably damaging 1.00
R5656:Tenm3 UTSW 8 48,681,797 (GRCm39) missense probably damaging 1.00
R5931:Tenm3 UTSW 8 49,099,533 (GRCm39) missense probably benign 0.00
R5959:Tenm3 UTSW 8 49,099,482 (GRCm39) nonsense probably null
R5965:Tenm3 UTSW 8 48,681,543 (GRCm39) nonsense probably null
R6151:Tenm3 UTSW 8 48,848,608 (GRCm39) missense probably damaging 1.00
R6157:Tenm3 UTSW 8 48,751,843 (GRCm39) missense probably damaging 0.96
R6167:Tenm3 UTSW 8 48,707,657 (GRCm39) missense possibly damaging 0.46
R6217:Tenm3 UTSW 8 48,746,700 (GRCm39) missense probably damaging 0.99
R6233:Tenm3 UTSW 8 48,870,094 (GRCm39) missense probably damaging 1.00
R6270:Tenm3 UTSW 8 48,820,429 (GRCm39) missense probably damaging 0.98
R6329:Tenm3 UTSW 8 48,729,884 (GRCm39) missense probably damaging 0.99
R6466:Tenm3 UTSW 8 48,689,098 (GRCm39) missense probably damaging 0.97
R6515:Tenm3 UTSW 8 48,870,257 (GRCm39) missense probably benign
R6516:Tenm3 UTSW 8 48,870,257 (GRCm39) missense probably benign
R6747:Tenm3 UTSW 8 48,796,278 (GRCm39) missense probably damaging 1.00
R6782:Tenm3 UTSW 8 49,099,291 (GRCm39) critical splice donor site probably null
R6788:Tenm3 UTSW 8 49,127,528 (GRCm39) missense probably damaging 1.00
R6823:Tenm3 UTSW 8 48,709,872 (GRCm39) missense probably damaging 0.99
R6846:Tenm3 UTSW 8 48,729,773 (GRCm39) missense probably benign 0.39
R6913:Tenm3 UTSW 8 48,751,972 (GRCm39) missense probably damaging 0.99
R6941:Tenm3 UTSW 8 49,127,451 (GRCm39) missense probably damaging 0.99
R6950:Tenm3 UTSW 8 48,693,514 (GRCm39) nonsense probably null
R6968:Tenm3 UTSW 8 48,689,474 (GRCm39) missense probably damaging 1.00
R6970:Tenm3 UTSW 8 48,689,474 (GRCm39) missense probably damaging 1.00
R6993:Tenm3 UTSW 8 48,689,474 (GRCm39) missense probably damaging 1.00
R7003:Tenm3 UTSW 8 48,693,479 (GRCm39) missense probably damaging 1.00
R7125:Tenm3 UTSW 8 49,127,588 (GRCm39) missense probably benign 0.00
R7140:Tenm3 UTSW 8 48,745,271 (GRCm39) missense probably damaging 1.00
R7222:Tenm3 UTSW 8 48,754,004 (GRCm39) missense probably damaging 1.00
R7232:Tenm3 UTSW 8 48,688,970 (GRCm39) missense probably damaging 1.00
R7336:Tenm3 UTSW 8 48,689,212 (GRCm39) missense possibly damaging 0.93
R7417:Tenm3 UTSW 8 48,689,218 (GRCm39) missense probably damaging 1.00
R7526:Tenm3 UTSW 8 48,740,847 (GRCm39) missense probably damaging 0.96
R7527:Tenm3 UTSW 8 48,729,635 (GRCm39) missense possibly damaging 0.60
R7616:Tenm3 UTSW 8 48,794,084 (GRCm39) missense possibly damaging 0.56
R7662:Tenm3 UTSW 8 48,788,762 (GRCm39) missense probably benign 0.27
R7734:Tenm3 UTSW 8 49,099,368 (GRCm39) missense probably damaging 1.00
R7802:Tenm3 UTSW 8 48,689,500 (GRCm39) missense probably damaging 1.00
R7812:Tenm3 UTSW 8 48,729,335 (GRCm39) missense probably benign 0.01
R7843:Tenm3 UTSW 8 48,682,146 (GRCm39) nonsense probably null
R7951:Tenm3 UTSW 8 48,763,738 (GRCm39) missense possibly damaging 0.86
R8293:Tenm3 UTSW 8 48,820,457 (GRCm39) missense possibly damaging 0.91
R8336:Tenm3 UTSW 8 48,746,808 (GRCm39) missense probably damaging 1.00
R8351:Tenm3 UTSW 8 48,740,907 (GRCm39) missense probably damaging 0.96
R8387:Tenm3 UTSW 8 48,740,883 (GRCm39) missense probably damaging 0.98
R8414:Tenm3 UTSW 8 48,746,544 (GRCm39) missense probably damaging 1.00
R8451:Tenm3 UTSW 8 48,740,907 (GRCm39) missense probably damaging 0.96
R8465:Tenm3 UTSW 8 48,682,216 (GRCm39) missense probably damaging 1.00
R8528:Tenm3 UTSW 8 48,795,668 (GRCm39) missense probably damaging 1.00
R8717:Tenm3 UTSW 8 48,752,680 (GRCm39) missense possibly damaging 0.77
R8734:Tenm3 UTSW 8 48,802,391 (GRCm39) missense probably benign 0.16
R8781:Tenm3 UTSW 8 48,795,484 (GRCm39) frame shift probably null
R8820:Tenm3 UTSW 8 48,763,759 (GRCm39) missense probably damaging 0.96
R8821:Tenm3 UTSW 8 48,729,417 (GRCm39) missense
R8831:Tenm3 UTSW 8 48,729,417 (GRCm39) missense
R8853:Tenm3 UTSW 8 48,795,382 (GRCm39) missense probably damaging 1.00
R8900:Tenm3 UTSW 8 48,689,437 (GRCm39) missense probably damaging 1.00
R8931:Tenm3 UTSW 8 48,688,637 (GRCm39) missense probably damaging 1.00
R8933:Tenm3 UTSW 8 48,732,095 (GRCm39) missense possibly damaging 0.53
R8989:Tenm3 UTSW 8 48,688,383 (GRCm39) nonsense probably null
R8998:Tenm3 UTSW 8 48,729,722 (GRCm39) missense probably damaging 1.00
R9008:Tenm3 UTSW 8 48,795,688 (GRCm39) missense probably damaging 0.98
R9017:Tenm3 UTSW 8 48,707,668 (GRCm39) missense probably damaging 0.99
R9101:Tenm3 UTSW 8 48,745,186 (GRCm39) missense probably damaging 1.00
R9108:Tenm3 UTSW 8 48,766,271 (GRCm39) critical splice donor site probably null
R9142:Tenm3 UTSW 8 48,788,548 (GRCm39) missense unknown
R9231:Tenm3 UTSW 8 48,689,231 (GRCm39) missense probably damaging 1.00
R9309:Tenm3 UTSW 8 48,751,972 (GRCm39) missense probably damaging 0.99
R9310:Tenm3 UTSW 8 49,008,935 (GRCm39) unclassified probably benign
R9336:Tenm3 UTSW 8 48,870,115 (GRCm39) missense probably damaging 1.00
R9373:Tenm3 UTSW 8 48,752,690 (GRCm39) missense probably damaging 1.00
R9393:Tenm3 UTSW 8 49,127,559 (GRCm39) missense probably damaging 0.99
R9509:Tenm3 UTSW 8 48,766,292 (GRCm39) nonsense probably null
R9575:Tenm3 UTSW 8 48,688,796 (GRCm39) missense possibly damaging 0.94
R9698:Tenm3 UTSW 8 48,689,246 (GRCm39) missense probably damaging 1.00
R9722:Tenm3 UTSW 8 48,753,849 (GRCm39) missense probably benign 0.00
R9788:Tenm3 UTSW 8 48,788,596 (GRCm39) missense probably benign 0.02
X0010:Tenm3 UTSW 8 48,740,864 (GRCm39) missense probably damaging 0.98
X0025:Tenm3 UTSW 8 48,689,512 (GRCm39) missense probably damaging 1.00
Z1177:Tenm3 UTSW 8 48,729,815 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAGAGACTAGGCTGTAG -3'
(R):5'- AAGGCTTCTGTCACTTGGACC -3'

Sequencing Primer
(F):5'- GGCCCCTACCTATAACGATCGTG -3'
(R):5'- CCGTCCATCAAGAACTGCTTTC -3'
Posted On 2017-07-14