Incidental Mutation 'R6062:Olfr912'
ID483854
Institutional Source Beutler Lab
Gene Symbol Olfr912
Ensembl Gene ENSMUSG00000111448
Gene Nameolfactory receptor 912
SynonymsMOR165-4, GA_x6K02T2PVTD-32283590-32284522
MMRRC Submission 044227-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.313) question?
Stock #R6062 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location38580178-38586876 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38539144 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 83 (M83K)
Ref Sequence ENSEMBL: ENSMUSP00000149263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000215122]
Predicted Effect probably damaging
Transcript: ENSMUST00000073214
AA Change: M83K

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000072947
Gene: ENSMUSG00000057444
AA Change: M83K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.9e-49 PFAM
Pfam:7tm_1 41 290 4.2e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215122
AA Change: M83K

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 G T 4: 58,826,453 S1038Y possibly damaging Het
Atat1 T A 17: 35,908,564 Q136L probably damaging Het
Atm A G 9: 53,488,587 L1531P probably damaging Het
Brca2 G A 5: 150,556,889 R2708H probably damaging Het
Cand1 G A 10: 119,218,010 A141V possibly damaging Het
Cdcp2 T C 4: 107,102,492 S35P probably damaging Het
Ces4a G A 8: 105,138,174 probably null Het
Colec10 T A 15: 54,459,807 M142K possibly damaging Het
Crtc1 G T 8: 70,406,189 D90E probably damaging Het
Csmd1 T C 8: 16,092,305 E1528G possibly damaging Het
Csnk2a2 A G 8: 95,457,469 V154A possibly damaging Het
Daglb T C 5: 143,494,603 I454T probably benign Het
Dtna C A 18: 23,622,056 N478K possibly damaging Het
E330034G19Rik A T 14: 24,293,380 probably benign Het
Eefsec A T 6: 88,355,629 S200T probably benign Het
Enthd1 T A 15: 80,452,715 D506V probably damaging Het
Erbb2 A G 11: 98,433,249 Y736C probably damaging Het
Gabrg1 A G 5: 70,780,713 C183R probably damaging Het
Ginm1 T A 10: 7,775,333 H103L probably benign Het
Golgb1 C A 16: 36,914,671 Q1427K possibly damaging Het
Grb14 G T 2: 65,022,620 Q9K possibly damaging Het
Hbp1 A T 12: 31,937,247 M192K probably damaging Het
Herpud2 A T 9: 25,108,988 D357E probably damaging Het
Idi1 A G 13: 8,887,505 S111G probably damaging Het
Lrrc32 T C 7: 98,498,541 V176A probably benign Het
Matn1 T A 4: 130,951,966 D310E probably benign Het
Mbtps1 A T 8: 119,531,091 L469Q possibly damaging Het
Muc4 A G 16: 32,759,308 D2417G unknown Het
Myo7b T C 18: 31,967,990 T1551A possibly damaging Het
Neb A G 2: 52,185,281 M224T probably benign Het
Ola1 A T 2: 73,199,498 D92E probably damaging Het
Olfr1019 T G 2: 85,841,114 I226L probably benign Het
Olfr388-ps1 A C 11: 73,724,560 C155G unknown Het
Olfr723 A T 14: 49,928,662 M294K probably damaging Het
Otud4 T C 8: 79,673,896 Y1080H probably damaging Het
Plce1 G A 19: 38,524,751 A165T probably benign Het
Prelid2 T C 18: 41,912,465 I127V probably benign Het
Rab35 A G 5: 115,640,088 I38V probably damaging Het
Rab3d T C 9: 21,910,519 T209A probably benign Het
Rapgef1 A G 2: 29,700,732 E321G probably damaging Het
Rem1 T C 2: 152,628,097 M1T probably null Het
Rgsl1 T C 1: 153,799,872 K181R possibly damaging Het
Scel C A 14: 103,585,136 N395K possibly damaging Het
Sept9 A G 11: 117,290,800 E142G possibly damaging Het
Shcbp1 A C 8: 4,764,905 M191R probably benign Het
Slc22a19 T C 19: 7,674,282 N520S probably damaging Het
Slc28a1 C T 7: 81,115,563 R9* probably null Het
Slc2a7 T C 4: 150,168,427 V508A probably benign Het
Slc8a3 G A 12: 81,314,350 P565L probably damaging Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Tenm3 T G 8: 48,343,406 I455L possibly damaging Het
Tmem267 T C 13: 119,609,231 S141P probably damaging Het
Tnn T A 1: 160,098,278 D1383V probably damaging Het
Usp9y G T Y: 1,454,199 Q23K probably benign Het
Vmn1r46 T C 6: 89,976,259 I30T possibly damaging Het
Zfp382 T C 7: 30,133,590 L222P probably damaging Het
Zfp950 T A 19: 61,120,425 K73N possibly damaging Het
Other mutations in Olfr912
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Olfr912 APN 9 38581376 missense probably damaging 0.97
IGL01099:Olfr912 APN 9 38582077 missense probably benign 0.00
IGL01749:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL01750:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL01751:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL01752:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL01753:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02262:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02264:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02298:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02305:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02309:Olfr912 APN 9 38581433 missense probably damaging 1.00
IGL02309:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02317:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02401:Olfr912 APN 9 38581355 missense probably damaging 1.00
R0311:Olfr912 UTSW 9 38539297 missense probably benign 0.42
R0973:Olfr912 UTSW 9 38581283 missense possibly damaging 0.74
R1552:Olfr912 UTSW 9 38581379 missense probably benign 0.00
R1720:Olfr912 UTSW 9 38581289 missense probably benign
R2149:Olfr912 UTSW 9 38581508 missense probably benign 0.02
R2241:Olfr912 UTSW 9 38581805 missense probably damaging 1.00
R3622:Olfr912 UTSW 9 38581496 missense probably damaging 1.00
R4384:Olfr912 UTSW 9 38582053 missense probably damaging 1.00
R4686:Olfr912 UTSW 9 38582031 missense probably damaging 1.00
R4780:Olfr912 UTSW 9 38581969 missense possibly damaging 0.84
R5221:Olfr912 UTSW 9 38581852 missense probably damaging 1.00
R5503:Olfr912 UTSW 9 38582072 missense probably benign
R5887:Olfr912 UTSW 9 38581784 missense probably damaging 1.00
R6516:Olfr912 UTSW 9 38581472 missense probably damaging 1.00
R6542:Olfr912 UTSW 9 38539437 missense probably benign 0.01
R6766:Olfr912 UTSW 9 38581773 missense probably damaging 1.00
R7057:Olfr912 UTSW 9 38581754 missense probably damaging 1.00
R7112:Olfr912 UTSW 9 38582034 nonsense probably null
R7414:Olfr912 UTSW 9 38581468 missense probably benign 0.00
R7514:Olfr912 UTSW 9 38582051 missense probably damaging 0.96
Z1176:Olfr912 UTSW 9 38581885 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGACAAATGGCTCTTTGGTAAC -3'
(R):5'- ACAGACTTTAGGGGACATGGTAAC -3'

Sequencing Primer
(F):5'- GGTAACAGAATTCATTCTTTTGGGG -3'
(R):5'- GGTAACATTATACATGAGTGGATTGC -3'
Posted On2017-07-14