Incidental Mutation 'R6062:Ginm1'
ID483856
Institutional Source Beutler Lab
Gene Symbol Ginm1
Ensembl Gene ENSMUSG00000040006
Gene Nameglycoprotein integral membrane 1
SynonymsBC013529
MMRRC Submission 044227-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6062 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location7767947-7792824 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7775333 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 103 (H103L)
Ref Sequence ENSEMBL: ENSMUSP00000119129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039763] [ENSMUST00000124838]
Predicted Effect probably benign
Transcript: ENSMUST00000039763
AA Change: H103L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000040961
Gene: ENSMUSG00000040006
AA Change: H103L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 260 282 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124447
Predicted Effect probably benign
Transcript: ENSMUST00000124838
AA Change: H103L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000119129
Gene: ENSMUSG00000040006
AA Change: H103L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 261 283 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133796
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180853
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 98% (56/57)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 G T 4: 58,826,453 S1038Y possibly damaging Het
Atat1 T A 17: 35,908,564 Q136L probably damaging Het
Atm A G 9: 53,488,587 L1531P probably damaging Het
Brca2 G A 5: 150,556,889 R2708H probably damaging Het
Cand1 G A 10: 119,218,010 A141V possibly damaging Het
Cdcp2 T C 4: 107,102,492 S35P probably damaging Het
Ces4a G A 8: 105,138,174 probably null Het
Colec10 T A 15: 54,459,807 M142K possibly damaging Het
Crtc1 G T 8: 70,406,189 D90E probably damaging Het
Csmd1 T C 8: 16,092,305 E1528G possibly damaging Het
Csnk2a2 A G 8: 95,457,469 V154A possibly damaging Het
Daglb T C 5: 143,494,603 I454T probably benign Het
Dtna C A 18: 23,622,056 N478K possibly damaging Het
E330034G19Rik A T 14: 24,293,380 probably benign Het
Eefsec A T 6: 88,355,629 S200T probably benign Het
Enthd1 T A 15: 80,452,715 D506V probably damaging Het
Erbb2 A G 11: 98,433,249 Y736C probably damaging Het
Gabrg1 A G 5: 70,780,713 C183R probably damaging Het
Golgb1 C A 16: 36,914,671 Q1427K possibly damaging Het
Grb14 G T 2: 65,022,620 Q9K possibly damaging Het
Hbp1 A T 12: 31,937,247 M192K probably damaging Het
Herpud2 A T 9: 25,108,988 D357E probably damaging Het
Idi1 A G 13: 8,887,505 S111G probably damaging Het
Lrrc32 T C 7: 98,498,541 V176A probably benign Het
Matn1 T A 4: 130,951,966 D310E probably benign Het
Mbtps1 A T 8: 119,531,091 L469Q possibly damaging Het
Muc4 A G 16: 32,759,308 D2417G unknown Het
Myo7b T C 18: 31,967,990 T1551A possibly damaging Het
Neb A G 2: 52,185,281 M224T probably benign Het
Ola1 A T 2: 73,199,498 D92E probably damaging Het
Olfr1019 T G 2: 85,841,114 I226L probably benign Het
Olfr388-ps1 A C 11: 73,724,560 C155G unknown Het
Olfr723 A T 14: 49,928,662 M294K probably damaging Het
Olfr912 T A 9: 38,539,144 M83K probably damaging Het
Otud4 T C 8: 79,673,896 Y1080H probably damaging Het
Plce1 G A 19: 38,524,751 A165T probably benign Het
Prelid2 T C 18: 41,912,465 I127V probably benign Het
Rab35 A G 5: 115,640,088 I38V probably damaging Het
Rab3d T C 9: 21,910,519 T209A probably benign Het
Rapgef1 A G 2: 29,700,732 E321G probably damaging Het
Rem1 T C 2: 152,628,097 M1T probably null Het
Rgsl1 T C 1: 153,799,872 K181R possibly damaging Het
Scel C A 14: 103,585,136 N395K possibly damaging Het
Sept9 A G 11: 117,290,800 E142G possibly damaging Het
Shcbp1 A C 8: 4,764,905 M191R probably benign Het
Slc22a19 T C 19: 7,674,282 N520S probably damaging Het
Slc28a1 C T 7: 81,115,563 R9* probably null Het
Slc2a7 T C 4: 150,168,427 V508A probably benign Het
Slc8a3 G A 12: 81,314,350 P565L probably damaging Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Tenm3 T G 8: 48,343,406 I455L possibly damaging Het
Tmem267 T C 13: 119,609,231 S141P probably damaging Het
Tnn T A 1: 160,098,278 D1383V probably damaging Het
Usp9y G T Y: 1,454,199 Q23K probably benign Het
Vmn1r46 T C 6: 89,976,259 I30T possibly damaging Het
Zfp382 T C 7: 30,133,590 L222P probably damaging Het
Zfp950 T A 19: 61,120,425 K73N possibly damaging Het
Other mutations in Ginm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Ginm1 APN 10 7792696 unclassified probably benign
IGL02474:Ginm1 APN 10 7777768 splice site probably benign
IGL02606:Ginm1 APN 10 7770399 missense probably damaging 0.98
R0010:Ginm1 UTSW 10 7775374 splice site probably benign
R0010:Ginm1 UTSW 10 7775374 splice site probably benign
R0052:Ginm1 UTSW 10 7779306 missense possibly damaging 0.92
R0052:Ginm1 UTSW 10 7779306 missense possibly damaging 0.92
R1901:Ginm1 UTSW 10 7775216 critical splice donor site probably null
R2106:Ginm1 UTSW 10 7775326 missense probably damaging 1.00
R5374:Ginm1 UTSW 10 7779314 missense probably damaging 0.99
R5929:Ginm1 UTSW 10 7774050 missense probably benign 0.16
R6102:Ginm1 UTSW 10 7768496 missense probably benign 0.00
R6792:Ginm1 UTSW 10 7773983 missense probably damaging 1.00
R7326:Ginm1 UTSW 10 7777850 nonsense probably null
R7417:Ginm1 UTSW 10 7774080 missense probably damaging 0.99
R7663:Ginm1 UTSW 10 7775362 missense possibly damaging 0.84
R7757:Ginm1 UTSW 10 7779355 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGTACCTTCCTGCTAATCG -3'
(R):5'- TCTGAGACTGGTAAGGTCAAGG -3'

Sequencing Primer
(F):5'- TCCTGCTAATCGTTCCAGAAAC -3'
(R):5'- CTGGTAAGGTCAAGGACAGAG -3'
Posted On2017-07-14