Incidental Mutation 'R6062:Erbb2'
ID483859
Institutional Source Beutler Lab
Gene Symbol Erbb2
Ensembl Gene ENSMUSG00000062312
Gene Nameerb-b2 receptor tyrosine kinase 2
Synonymsc-erbB2, c-neu, HER-2, HER2, Neu, ErbB-2, Neu oncogene
MMRRC Submission 044227-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6062 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location98412470-98437716 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 98433249 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 736 (Y736C)
Ref Sequence ENSEMBL: ENSMUSP00000053897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002655] [ENSMUST00000058295]
Predicted Effect probably benign
Transcript: ENSMUST00000002655
SMART Domains Protein: ENSMUSP00000002655
Gene: ENSMUSG00000002580

DomainStartEndE-ValueType
Pfam:Rdx 23 96 1.6e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000058295
AA Change: Y736C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053897
Gene: ENSMUSG00000062312
AA Change: Y736C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Recep_L_domain 52 174 2e-32 PFAM
FU 190 231 1.88e1 SMART
FU 233 276 1.03e-6 SMART
Pfam:Recep_L_domain 367 487 2.3e-23 PFAM
FU 502 551 3.08e-5 SMART
FU 558 607 3.97e-8 SMART
transmembrane domain 654 676 N/A INTRINSIC
TyrKc 721 977 1.28e-126 SMART
low complexity region 1040 1080 N/A INTRINSIC
low complexity region 1148 1163 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154452
Meta Mutation Damage Score 0.9193 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epidermal growth factor (EGF) receptor family of receptor tyrosine kinases. This protein has no ligand binding domain of its own and therefore cannot bind growth factors. However, it does bind tightly to other ligand-bound EGF receptor family members to form a heterodimer, stabilizing ligand binding and enhancing kinase-mediated activation of downstream signalling pathways, such as those involving mitogen-activated protein kinase and phosphatidylinositol-3 kinase. Allelic variations at amino acid positions 654 and 655 of isoform a (positions 624 and 625 of isoform b) have been reported, with the most common allele, Ile654/Ile655, shown here. Amplification and/or overexpression of this gene has been reported in numerous cancers, including breast and ovarian tumors. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit degeneration of motor nerves, an absence of Schwann cells, impairment of junctional folds at the neuromuscular synapse, and cardiac defects that results in lethality by embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 G T 4: 58,826,453 S1038Y possibly damaging Het
Atat1 T A 17: 35,908,564 Q136L probably damaging Het
Atm A G 9: 53,488,587 L1531P probably damaging Het
Brca2 G A 5: 150,556,889 R2708H probably damaging Het
Cand1 G A 10: 119,218,010 A141V possibly damaging Het
Cdcp2 T C 4: 107,102,492 S35P probably damaging Het
Ces4a G A 8: 105,138,174 probably null Het
Colec10 T A 15: 54,459,807 M142K possibly damaging Het
Crtc1 G T 8: 70,406,189 D90E probably damaging Het
Csmd1 T C 8: 16,092,305 E1528G possibly damaging Het
Csnk2a2 A G 8: 95,457,469 V154A possibly damaging Het
Daglb T C 5: 143,494,603 I454T probably benign Het
Dtna C A 18: 23,622,056 N478K possibly damaging Het
E330034G19Rik A T 14: 24,293,380 probably benign Het
Eefsec A T 6: 88,355,629 S200T probably benign Het
Enthd1 T A 15: 80,452,715 D506V probably damaging Het
Gabrg1 A G 5: 70,780,713 C183R probably damaging Het
Ginm1 T A 10: 7,775,333 H103L probably benign Het
Golgb1 C A 16: 36,914,671 Q1427K possibly damaging Het
Grb14 G T 2: 65,022,620 Q9K possibly damaging Het
Hbp1 A T 12: 31,937,247 M192K probably damaging Het
Herpud2 A T 9: 25,108,988 D357E probably damaging Het
Idi1 A G 13: 8,887,505 S111G probably damaging Het
Lrrc32 T C 7: 98,498,541 V176A probably benign Het
Matn1 T A 4: 130,951,966 D310E probably benign Het
Mbtps1 A T 8: 119,531,091 L469Q possibly damaging Het
Muc4 A G 16: 32,759,308 D2417G unknown Het
Myo7b T C 18: 31,967,990 T1551A possibly damaging Het
Neb A G 2: 52,185,281 M224T probably benign Het
Ola1 A T 2: 73,199,498 D92E probably damaging Het
Olfr1019 T G 2: 85,841,114 I226L probably benign Het
Olfr388-ps1 A C 11: 73,724,560 C155G unknown Het
Olfr723 A T 14: 49,928,662 M294K probably damaging Het
Olfr912 T A 9: 38,539,144 M83K probably damaging Het
Otud4 T C 8: 79,673,896 Y1080H probably damaging Het
Plce1 G A 19: 38,524,751 A165T probably benign Het
Prelid2 T C 18: 41,912,465 I127V probably benign Het
Rab35 A G 5: 115,640,088 I38V probably damaging Het
Rab3d T C 9: 21,910,519 T209A probably benign Het
Rapgef1 A G 2: 29,700,732 E321G probably damaging Het
Rem1 T C 2: 152,628,097 M1T probably null Het
Rgsl1 T C 1: 153,799,872 K181R possibly damaging Het
Scel C A 14: 103,585,136 N395K possibly damaging Het
Sept9 A G 11: 117,290,800 E142G possibly damaging Het
Shcbp1 A C 8: 4,764,905 M191R probably benign Het
Slc22a19 T C 19: 7,674,282 N520S probably damaging Het
Slc28a1 C T 7: 81,115,563 R9* probably null Het
Slc2a7 T C 4: 150,168,427 V508A probably benign Het
Slc8a3 G A 12: 81,314,350 P565L probably damaging Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Tenm3 T G 8: 48,343,406 I455L possibly damaging Het
Tmem267 T C 13: 119,609,231 S141P probably damaging Het
Tnn T A 1: 160,098,278 D1383V probably damaging Het
Usp9y G T Y: 1,454,199 Q23K probably benign Het
Vmn1r46 T C 6: 89,976,259 I30T possibly damaging Het
Zfp382 T C 7: 30,133,590 L222P probably damaging Het
Zfp950 T A 19: 61,120,425 K73N possibly damaging Het
Other mutations in Erbb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Erbb2 APN 11 98435630 missense probably damaging 1.00
IGL01460:Erbb2 APN 11 98434539 missense probably damaging 1.00
IGL01483:Erbb2 APN 11 98434539 missense probably damaging 1.00
IGL01514:Erbb2 APN 11 98432919 missense possibly damaging 0.94
IGL01520:Erbb2 APN 11 98434009 missense probably benign 0.05
IGL03007:Erbb2 APN 11 98428993 splice site probably benign
IGL03367:Erbb2 APN 11 98422875 splice site probably null
Angular UTSW 11 98422770 missense probably damaging 0.98
PIT4544001:Erbb2 UTSW 11 98421039 missense probably benign
R0234:Erbb2 UTSW 11 98436439 missense probably benign 0.33
R0234:Erbb2 UTSW 11 98436439 missense probably benign 0.33
R0388:Erbb2 UTSW 11 98427351 missense possibly damaging 0.66
R0602:Erbb2 UTSW 11 98434271 missense probably damaging 1.00
R1467:Erbb2 UTSW 11 98436175 nonsense probably null
R1467:Erbb2 UTSW 11 98436175 nonsense probably null
R1500:Erbb2 UTSW 11 98428978 missense probably damaging 1.00
R1651:Erbb2 UTSW 11 98433457 missense probably damaging 1.00
R1748:Erbb2 UTSW 11 98435335 missense probably benign 0.06
R1807:Erbb2 UTSW 11 98428854 missense probably damaging 1.00
R1861:Erbb2 UTSW 11 98412737 critical splice donor site probably null
R1926:Erbb2 UTSW 11 98425164 missense probably benign
R1998:Erbb2 UTSW 11 98428953 missense probably damaging 1.00
R2051:Erbb2 UTSW 11 98420172 missense probably damaging 1.00
R3147:Erbb2 UTSW 11 98434039 missense probably damaging 1.00
R4022:Erbb2 UTSW 11 98435297 missense probably benign 0.09
R4238:Erbb2 UTSW 11 98428043 missense probably benign 0.01
R4239:Erbb2 UTSW 11 98428043 missense probably benign 0.01
R4240:Erbb2 UTSW 11 98428043 missense probably benign 0.01
R4633:Erbb2 UTSW 11 98432988 missense possibly damaging 0.91
R4725:Erbb2 UTSW 11 98425144 missense possibly damaging 0.71
R5093:Erbb2 UTSW 11 98427453 missense probably damaging 1.00
R5306:Erbb2 UTSW 11 98428206 missense probably benign 0.44
R5375:Erbb2 UTSW 11 98433412 missense probably damaging 1.00
R5518:Erbb2 UTSW 11 98422770 missense probably damaging 0.98
R5710:Erbb2 UTSW 11 98427080 missense probably damaging 1.00
R5938:Erbb2 UTSW 11 98435571 missense probably damaging 0.99
R6116:Erbb2 UTSW 11 98427399 missense probably damaging 1.00
R6514:Erbb2 UTSW 11 98420146 missense probably benign 0.03
R6556:Erbb2 UTSW 11 98436082 missense possibly damaging 0.92
R6570:Erbb2 UTSW 11 98423047 missense possibly damaging 0.88
R6578:Erbb2 UTSW 11 98428188 missense probably damaging 1.00
R7141:Erbb2 UTSW 11 98427309 missense probably damaging 1.00
R7686:Erbb2 UTSW 11 98435573 missense probably benign
X0028:Erbb2 UTSW 11 98434301 missense probably damaging 1.00
X0062:Erbb2 UTSW 11 98423120 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TATACCATGCGTAGGCTGC -3'
(R):5'- GGGGATTTTCACGTTCTCCC -3'

Sequencing Primer
(F):5'- ATGCGTAGGCTGCTGCAG -3'
(R):5'- GGATTTTCACGTTCTCCCCATCTG -3'
Posted On2017-07-14