Mutagenetix > Incidental Mutation

Incidental Mutation 'R6062:Slc8a3'

483862

Institutional Source

Beutler Lab

Gene Symbol

Slc8a3

Ensembl Gene

ENSMUSG00000079055

Gene Name

solute carrier family 8 (sodium/calcium exchanger), member 3

Synonyms

Ncx3

MMRRC Submission

044227-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6062 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

81197915-81333180 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 81314350 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 565 (P565L)

Ref Sequence

ENSEMBL: ENSMUSP00000138735 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208]

AlphaFold

S4R2P9

Predicted Effect

probably damaging
Transcript: ENSMUST00000064594
AA Change: P565L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: P565L

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	754	919	2e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000085238
AA Change: P565L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: P565L

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	79	250	1.3e-36	PFAM
Pfam:Na_Ca_ex_C	253	379	4.6e-57	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.54e-43	SMART
low complexity region	705	716	N/A	INTRINSIC
Pfam:Na_Ca_ex	747	912	1.9e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000182208
AA Change: P565L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: P565L

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
Pfam:Na_Ca_ex	89	248	8.1e-38	PFAM
Calx_beta	385	485	3.25e-42	SMART
Calx_beta	519	619	1.04e-40	SMART
low complexity region	712	723	N/A	INTRINSIC
Pfam:Na_Ca_ex	764	917	9.1e-27	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183102

Meta Mutation Damage Score

0.5949

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.9%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AI314180	G	T	4: 58,826,453	S1038Y	possibly damaging	Het
Atat1	T	A	17: 35,908,564	Q136L	probably damaging	Het
Atm	A	G	9: 53,488,587	L1531P	probably damaging	Het
Brca2	G	A	5: 150,556,889	R2708H	probably damaging	Het
Cand1	G	A	10: 119,218,010	A141V	possibly damaging	Het
Cdcp2	T	C	4: 107,102,492	S35P	probably damaging	Het
Ces4a	G	A	8: 105,138,174		probably null	Het
Colec10	T	A	15: 54,459,807	M142K	possibly damaging	Het
Crtc1	G	T	8: 70,406,189	D90E	probably damaging	Het
Csmd1	T	C	8: 16,092,305	E1528G	possibly damaging	Het
Csnk2a2	A	G	8: 95,457,469	V154A	possibly damaging	Het
Daglb	T	C	5: 143,494,603	I454T	probably benign	Het
Dtna	C	A	18: 23,622,056	N478K	possibly damaging	Het
E330034G19Rik	A	T	14: 24,293,380		probably benign	Het
Eefsec	A	T	6: 88,355,629	S200T	probably benign	Het
Enthd1	T	A	15: 80,452,715	D506V	probably damaging	Het
Erbb2	A	G	11: 98,433,249	Y736C	probably damaging	Het
Gabrg1	A	G	5: 70,780,713	C183R	probably damaging	Het
Ginm1	T	A	10: 7,775,333	H103L	probably benign	Het
Golgb1	C	A	16: 36,914,671	Q1427K	possibly damaging	Het
Grb14	G	T	2: 65,022,620	Q9K	possibly damaging	Het
Hbp1	A	T	12: 31,937,247	M192K	probably damaging	Het
Herpud2	A	T	9: 25,108,988	D357E	probably damaging	Het
Idi1	A	G	13: 8,887,505	S111G	probably damaging	Het
Lrrc32	T	C	7: 98,498,541	V176A	probably benign	Het
Matn1	T	A	4: 130,951,966	D310E	probably benign	Het
Mbtps1	A	T	8: 119,531,091	L469Q	possibly damaging	Het
Muc4	A	G	16: 32,759,308	D2417G	unknown	Het
Myo7b	T	C	18: 31,967,990	T1551A	possibly damaging	Het
Neb	A	G	2: 52,185,281	M224T	probably benign	Het
Ola1	A	T	2: 73,199,498	D92E	probably damaging	Het
Olfr1019	T	G	2: 85,841,114	I226L	probably benign	Het
Olfr388-ps1	A	C	11: 73,724,560	C155G	unknown	Het
Olfr723	A	T	14: 49,928,662	M294K	probably damaging	Het
Olfr912	T	A	9: 38,539,144	M83K	probably damaging	Het
Otud4	T	C	8: 79,673,896	Y1080H	probably damaging	Het
Plce1	G	A	19: 38,524,751	A165T	probably benign	Het
Prelid2	T	C	18: 41,912,465	I127V	probably benign	Het
Rab35	A	G	5: 115,640,088	I38V	probably damaging	Het
Rab3d	T	C	9: 21,910,519	T209A	probably benign	Het
Rapgef1	A	G	2: 29,700,732	E321G	probably damaging	Het
Rem1	T	C	2: 152,628,097	M1T	probably null	Het
Rgsl1	T	C	1: 153,799,872	K181R	possibly damaging	Het
Scel	C	A	14: 103,585,136	N395K	possibly damaging	Het
Sept9	A	G	11: 117,290,800	E142G	possibly damaging	Het
Shcbp1	A	C	8: 4,764,905	M191R	probably benign	Het
Slc22a19	T	C	19: 7,674,282	N520S	probably damaging	Het
Slc28a1	C	T	7: 81,115,563	R9*	probably null	Het
Slc2a7	T	C	4: 150,168,427	V508A	probably benign	Het
Svil	T	G	18: 5,106,724	V1855G	probably damaging	Het
Tenm3	T	G	8: 48,343,406	I455L	possibly damaging	Het
Tmem267	T	C	13: 119,609,231	S141P	probably damaging	Het
Tnn	T	A	1: 160,098,278	D1383V	probably damaging	Het
Usp9y	G	T	Y: 1,454,199	Q23K	probably benign	Het
Vmn1r46	T	C	6: 89,976,259	I30T	possibly damaging	Het
Zfp382	T	C	7: 30,133,590	L222P	probably damaging	Het
Zfp950	T	A	19: 61,120,425	K73N	possibly damaging	Het

Other mutations in Slc8a3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Slc8a3	APN	12	81314569	missense	probably benign
IGL01315:Slc8a3	APN	12	81314395	missense	probably damaging	0.97
IGL01365:Slc8a3	APN	12	81315376	missense	probably damaging	0.99
IGL01610:Slc8a3	APN	12	81315802	missense	probably damaging	1.00
IGL02227:Slc8a3	APN	12	81315683	missense	probably damaging	1.00
IGL02299:Slc8a3	APN	12	81315224	missense	probably damaging	0.98
IGL02548:Slc8a3	APN	12	81204156	splice site	probably benign
IGL02646:Slc8a3	APN	12	81315094	missense	probably damaging	1.00
IGL03135:Slc8a3	APN	12	81202249	missense	probably damaging	1.00
R0050:Slc8a3	UTSW	12	81315265	missense	probably damaging	1.00
R0627:Slc8a3	UTSW	12	81314842	missense	probably damaging	1.00
R0648:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1342:Slc8a3	UTSW	12	81316016	missense	probably damaging	0.99
R1437:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1470:Slc8a3	UTSW	12	81199710	missense	probably benign
R1557:Slc8a3	UTSW	12	81315557	missense	probably damaging	1.00
R1563:Slc8a3	UTSW	12	81205007	missense	possibly damaging	0.47
R1918:Slc8a3	UTSW	12	81314844	missense	probably damaging	0.99
R1930:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R1931:Slc8a3	UTSW	12	81314446	missense	probably damaging	1.00
R2232:Slc8a3	UTSW	12	81315220	missense	probably damaging	0.99
R2680:Slc8a3	UTSW	12	81202339	missense	probably damaging	0.99
R2941:Slc8a3	UTSW	12	81315179	missense	probably damaging	1.00
R3157:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3159:Slc8a3	UTSW	12	81314992	missense	probably damaging	1.00
R3751:Slc8a3	UTSW	12	81204138	missense	probably damaging	1.00
R3859:Slc8a3	UTSW	12	81314872	missense	probably damaging	0.99
R4240:Slc8a3	UTSW	12	81315176	missense	probably damaging	0.99
R4527:Slc8a3	UTSW	12	81315853	missense	probably damaging	1.00
R4547:Slc8a3	UTSW	12	81314851	missense	possibly damaging	0.76
R4951:Slc8a3	UTSW	12	81314699	missense	probably benign	0.31
R4951:Slc8a3	UTSW	12	81315986	missense	probably damaging	0.99
R5022:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5049:Slc8a3	UTSW	12	81214132	missense	probably damaging	1.00
R5057:Slc8a3	UTSW	12	81199558	missense	probably damaging	0.96
R5104:Slc8a3	UTSW	12	81214134	missense	probably null	0.34
R5122:Slc8a3	UTSW	12	81314258	critical splice donor site	probably null
R5183:Slc8a3	UTSW	12	81314491	missense	possibly damaging	0.79
R5629:Slc8a3	UTSW	12	81199631	missense	probably damaging	1.00
R6218:Slc8a3	UTSW	12	81199567	missense	probably benign
R6279:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6300:Slc8a3	UTSW	12	81314978	missense	probably damaging	0.99
R6416:Slc8a3	UTSW	12	81315627	missense	probably damaging	1.00
R6790:Slc8a3	UTSW	12	81314432	missense	probably benign	0.00
R6999:Slc8a3	UTSW	12	81314755	missense	probably benign	0.06
R7195:Slc8a3	UTSW	12	81314273	missense	possibly damaging	0.95
R7268:Slc8a3	UTSW	12	81315053	missense	probably damaging	0.98
R7288:Slc8a3	UTSW	12	81216824	missense	possibly damaging	0.70
R7383:Slc8a3	UTSW	12	81315805	missense	probably damaging	1.00
R7392:Slc8a3	UTSW	12	81314803	missense	probably damaging	0.99
R7394:Slc8a3	UTSW	12	81214058	splice site	probably null
R7549:Slc8a3	UTSW	12	81314770	missense	probably benign	0.06
R7657:Slc8a3	UTSW	12	81314384	missense	probably damaging	1.00
R7699:Slc8a3	UTSW	12	81314473	missense	probably damaging	1.00
R7759:Slc8a3	UTSW	12	81314551	missense	probably benign
R7960:Slc8a3	UTSW	12	81216732	missense	probably benign	0.00
R7985:Slc8a3	UTSW	12	81314993	missense	probably damaging	1.00
R8059:Slc8a3	UTSW	12	81202258	missense	probably damaging	1.00
R8192:Slc8a3	UTSW	12	81199681	missense	probably damaging	1.00
R8397:Slc8a3	UTSW	12	81199768	missense	probably benign	0.45
R8413:Slc8a3	UTSW	12	81314678	missense	probably damaging	0.97
R8681:Slc8a3	UTSW	12	81315140	missense	probably benign
R9060:Slc8a3	UTSW	12	81214078	missense	probably benign	0.45
R9061:Slc8a3	UTSW	12	81216766	missense	probably damaging	0.99
R9267:Slc8a3	UTSW	12	81314434	missense	possibly damaging	0.77
R9416:Slc8a3	UTSW	12	81315064	missense	probably benign	0.06
R9519:Slc8a3	UTSW	12	81315552	missense	probably benign	0.30
R9531:Slc8a3	UTSW	12	81315223	missense	probably damaging	1.00
X0026:Slc8a3	UTSW	12	81315287	missense	probably benign	0.22
X0028:Slc8a3	UTSW	12	81314943	missense	probably damaging	1.00
Z1177:Slc8a3	UTSW	12	81314700	missense	possibly damaging	0.92
Z1177:Slc8a3	UTSW	12	81315876	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- CCTGTGATGAAAGCAAAGTTTGG -3'
(R):5'- AATAGTCTTCCTTTGCCTCGGG -3'

Sequencing Primer
(F):5'- TGAAAGCAAAGTTTGGGATTAACAC -3'
(R):5'- GGCTGTCCTGGCCTCCC -3'

Posted On

2017-07-14