Incidental Mutation 'R6062:Slc8a3'
ID 483862
Institutional Source Beutler Lab
Gene Symbol Slc8a3
Ensembl Gene ENSMUSG00000079055
Gene Name solute carrier family 8 (sodium/calcium exchanger), member 3
Synonyms Ncx3
MMRRC Submission 044227-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6062 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 81244689-81379954 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 81361124 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 565 (P565L)
Ref Sequence ENSEMBL: ENSMUSP00000138735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208]
AlphaFold S4R2P9
Predicted Effect probably damaging
Transcript: ENSMUST00000064594
AA Change: P565L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: P565L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 79 250 1.3e-36 PFAM
Pfam:Na_Ca_ex_C 253 379 4.6e-57 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.04e-40 SMART
low complexity region 712 723 N/A INTRINSIC
Pfam:Na_Ca_ex 754 919 2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000085238
AA Change: P565L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: P565L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 79 250 1.3e-36 PFAM
Pfam:Na_Ca_ex_C 253 379 4.6e-57 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.54e-43 SMART
low complexity region 705 716 N/A INTRINSIC
Pfam:Na_Ca_ex 747 912 1.9e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182208
AA Change: P565L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: P565L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 89 248 8.1e-38 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.04e-40 SMART
low complexity region 712 723 N/A INTRINSIC
Pfam:Na_Ca_ex 764 917 9.1e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183102
Meta Mutation Damage Score 0.5949 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atat1 T A 17: 36,219,456 (GRCm39) Q136L probably damaging Het
Atm A G 9: 53,399,887 (GRCm39) L1531P probably damaging Het
Brca2 G A 5: 150,480,354 (GRCm39) R2708H probably damaging Het
Cand1 G A 10: 119,053,915 (GRCm39) A141V possibly damaging Het
Cdcp2 T C 4: 106,959,689 (GRCm39) S35P probably damaging Het
Ces4a G A 8: 105,864,806 (GRCm39) probably null Het
Colec10 T A 15: 54,323,203 (GRCm39) M142K possibly damaging Het
Crtc1 G T 8: 70,858,839 (GRCm39) D90E probably damaging Het
Csmd1 T C 8: 16,142,319 (GRCm39) E1528G possibly damaging Het
Csnk2a2 A G 8: 96,184,097 (GRCm39) V154A possibly damaging Het
Daglb T C 5: 143,480,358 (GRCm39) I454T probably benign Het
Dtna C A 18: 23,755,113 (GRCm39) N478K possibly damaging Het
E330034G19Rik A T 14: 24,343,448 (GRCm39) probably benign Het
Ecpas G T 4: 58,826,453 (GRCm39) S1038Y possibly damaging Het
Eefsec A T 6: 88,332,611 (GRCm39) S200T probably benign Het
Enthd1 T A 15: 80,336,916 (GRCm39) D506V probably damaging Het
Erbb2 A G 11: 98,324,075 (GRCm39) Y736C probably damaging Het
Gabrg1 A G 5: 70,938,056 (GRCm39) C183R probably damaging Het
Ginm1 T A 10: 7,651,097 (GRCm39) H103L probably benign Het
Golgb1 C A 16: 36,735,033 (GRCm39) Q1427K possibly damaging Het
Grb14 G T 2: 64,852,964 (GRCm39) Q9K possibly damaging Het
Hbp1 A T 12: 31,987,246 (GRCm39) M192K probably damaging Het
Herpud2 A T 9: 25,020,284 (GRCm39) D357E probably damaging Het
Idi1 A G 13: 8,937,541 (GRCm39) S111G probably damaging Het
Lrrc32 T C 7: 98,147,748 (GRCm39) V176A probably benign Het
Matn1 T A 4: 130,679,277 (GRCm39) D310E probably benign Het
Mbtps1 A T 8: 120,257,830 (GRCm39) L469Q possibly damaging Het
Muc4 A G 16: 32,579,682 (GRCm39) D2417G unknown Het
Myo7b T C 18: 32,101,043 (GRCm39) T1551A possibly damaging Het
Neb A G 2: 52,075,293 (GRCm39) M224T probably benign Het
Ola1 A T 2: 73,029,842 (GRCm39) D92E probably damaging Het
Or1e28-ps1 A C 11: 73,615,386 (GRCm39) C155G unknown Het
Or4l1 A T 14: 50,166,119 (GRCm39) M294K probably damaging Het
Or5ar1 T G 2: 85,671,458 (GRCm39) I226L probably benign Het
Or8b48 T A 9: 38,450,440 (GRCm39) M83K probably damaging Het
Otud4 T C 8: 80,400,525 (GRCm39) Y1080H probably damaging Het
Plce1 G A 19: 38,513,195 (GRCm39) A165T probably benign Het
Prelid2 T C 18: 42,045,530 (GRCm39) I127V probably benign Het
Rab35 A G 5: 115,778,147 (GRCm39) I38V probably damaging Het
Rab3d T C 9: 21,821,815 (GRCm39) T209A probably benign Het
Rapgef1 A G 2: 29,590,744 (GRCm39) E321G probably damaging Het
Rem1 T C 2: 152,470,017 (GRCm39) M1T probably null Het
Rgsl1 T C 1: 153,675,618 (GRCm39) K181R possibly damaging Het
Scel C A 14: 103,822,572 (GRCm39) N395K possibly damaging Het
Septin9 A G 11: 117,181,626 (GRCm39) E142G possibly damaging Het
Shcbp1 A C 8: 4,814,905 (GRCm39) M191R probably benign Het
Slc22a19 T C 19: 7,651,647 (GRCm39) N520S probably damaging Het
Slc28a1 C T 7: 80,765,311 (GRCm39) R9* probably null Het
Slc2a7 T C 4: 150,252,884 (GRCm39) V508A probably benign Het
Svil T G 18: 5,106,724 (GRCm39) V1855G probably damaging Het
Tenm3 T G 8: 48,796,441 (GRCm39) I455L possibly damaging Het
Tmem267 T C 13: 120,070,767 (GRCm39) S141P probably damaging Het
Tnn T A 1: 159,925,848 (GRCm39) D1383V probably damaging Het
Usp9y G T Y: 1,454,199 (GRCm39) Q23K probably benign Het
Vmn1r46 T C 6: 89,953,241 (GRCm39) I30T possibly damaging Het
Zfp382 T C 7: 29,833,015 (GRCm39) L222P probably damaging Het
Zfp950 T A 19: 61,108,863 (GRCm39) K73N possibly damaging Het
Other mutations in Slc8a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Slc8a3 APN 12 81,361,343 (GRCm39) missense probably benign
IGL01315:Slc8a3 APN 12 81,361,169 (GRCm39) missense probably damaging 0.97
IGL01365:Slc8a3 APN 12 81,362,150 (GRCm39) missense probably damaging 0.99
IGL01610:Slc8a3 APN 12 81,362,576 (GRCm39) missense probably damaging 1.00
IGL02227:Slc8a3 APN 12 81,362,457 (GRCm39) missense probably damaging 1.00
IGL02299:Slc8a3 APN 12 81,361,998 (GRCm39) missense probably damaging 0.98
IGL02548:Slc8a3 APN 12 81,250,930 (GRCm39) splice site probably benign
IGL02646:Slc8a3 APN 12 81,361,868 (GRCm39) missense probably damaging 1.00
IGL03135:Slc8a3 APN 12 81,249,023 (GRCm39) missense probably damaging 1.00
R0050:Slc8a3 UTSW 12 81,362,039 (GRCm39) missense probably damaging 1.00
R0627:Slc8a3 UTSW 12 81,361,616 (GRCm39) missense probably damaging 1.00
R0648:Slc8a3 UTSW 12 81,361,220 (GRCm39) missense probably damaging 1.00
R1342:Slc8a3 UTSW 12 81,362,790 (GRCm39) missense probably damaging 0.99
R1437:Slc8a3 UTSW 12 81,362,760 (GRCm39) missense probably damaging 0.99
R1470:Slc8a3 UTSW 12 81,246,484 (GRCm39) missense probably benign
R1470:Slc8a3 UTSW 12 81,246,484 (GRCm39) missense probably benign
R1557:Slc8a3 UTSW 12 81,362,331 (GRCm39) missense probably damaging 1.00
R1563:Slc8a3 UTSW 12 81,251,781 (GRCm39) missense possibly damaging 0.47
R1918:Slc8a3 UTSW 12 81,361,618 (GRCm39) missense probably damaging 0.99
R1930:Slc8a3 UTSW 12 81,361,220 (GRCm39) missense probably damaging 1.00
R1931:Slc8a3 UTSW 12 81,361,220 (GRCm39) missense probably damaging 1.00
R2232:Slc8a3 UTSW 12 81,361,994 (GRCm39) missense probably damaging 0.99
R2680:Slc8a3 UTSW 12 81,249,113 (GRCm39) missense probably damaging 0.99
R2941:Slc8a3 UTSW 12 81,361,953 (GRCm39) missense probably damaging 1.00
R3157:Slc8a3 UTSW 12 81,361,766 (GRCm39) missense probably damaging 1.00
R3159:Slc8a3 UTSW 12 81,361,766 (GRCm39) missense probably damaging 1.00
R3751:Slc8a3 UTSW 12 81,250,912 (GRCm39) missense probably damaging 1.00
R3859:Slc8a3 UTSW 12 81,361,646 (GRCm39) missense probably damaging 0.99
R4240:Slc8a3 UTSW 12 81,361,950 (GRCm39) missense probably damaging 0.99
R4527:Slc8a3 UTSW 12 81,362,627 (GRCm39) missense probably damaging 1.00
R4547:Slc8a3 UTSW 12 81,361,625 (GRCm39) missense possibly damaging 0.76
R4951:Slc8a3 UTSW 12 81,362,760 (GRCm39) missense probably damaging 0.99
R4951:Slc8a3 UTSW 12 81,361,473 (GRCm39) missense probably benign 0.31
R5022:Slc8a3 UTSW 12 81,246,332 (GRCm39) missense probably damaging 0.96
R5049:Slc8a3 UTSW 12 81,260,906 (GRCm39) missense probably damaging 1.00
R5057:Slc8a3 UTSW 12 81,246,332 (GRCm39) missense probably damaging 0.96
R5104:Slc8a3 UTSW 12 81,260,908 (GRCm39) missense probably null 0.34
R5122:Slc8a3 UTSW 12 81,361,032 (GRCm39) critical splice donor site probably null
R5183:Slc8a3 UTSW 12 81,361,265 (GRCm39) missense possibly damaging 0.79
R5629:Slc8a3 UTSW 12 81,246,405 (GRCm39) missense probably damaging 1.00
R6218:Slc8a3 UTSW 12 81,246,341 (GRCm39) missense probably benign
R6279:Slc8a3 UTSW 12 81,361,752 (GRCm39) missense probably damaging 0.99
R6300:Slc8a3 UTSW 12 81,361,752 (GRCm39) missense probably damaging 0.99
R6416:Slc8a3 UTSW 12 81,362,401 (GRCm39) missense probably damaging 1.00
R6790:Slc8a3 UTSW 12 81,361,206 (GRCm39) missense probably benign 0.00
R6999:Slc8a3 UTSW 12 81,361,529 (GRCm39) missense probably benign 0.06
R7195:Slc8a3 UTSW 12 81,361,047 (GRCm39) missense possibly damaging 0.95
R7268:Slc8a3 UTSW 12 81,361,827 (GRCm39) missense probably damaging 0.98
R7288:Slc8a3 UTSW 12 81,263,598 (GRCm39) missense possibly damaging 0.70
R7383:Slc8a3 UTSW 12 81,362,579 (GRCm39) missense probably damaging 1.00
R7392:Slc8a3 UTSW 12 81,361,577 (GRCm39) missense probably damaging 0.99
R7394:Slc8a3 UTSW 12 81,260,832 (GRCm39) splice site probably null
R7549:Slc8a3 UTSW 12 81,361,544 (GRCm39) missense probably benign 0.06
R7657:Slc8a3 UTSW 12 81,361,158 (GRCm39) missense probably damaging 1.00
R7699:Slc8a3 UTSW 12 81,361,247 (GRCm39) missense probably damaging 1.00
R7759:Slc8a3 UTSW 12 81,361,325 (GRCm39) missense probably benign
R7960:Slc8a3 UTSW 12 81,263,506 (GRCm39) missense probably benign 0.00
R7985:Slc8a3 UTSW 12 81,361,767 (GRCm39) missense probably damaging 1.00
R8059:Slc8a3 UTSW 12 81,249,032 (GRCm39) missense probably damaging 1.00
R8192:Slc8a3 UTSW 12 81,246,455 (GRCm39) missense probably damaging 1.00
R8397:Slc8a3 UTSW 12 81,246,542 (GRCm39) missense probably benign 0.45
R8413:Slc8a3 UTSW 12 81,361,452 (GRCm39) missense probably damaging 0.97
R8681:Slc8a3 UTSW 12 81,361,914 (GRCm39) missense probably benign
R9060:Slc8a3 UTSW 12 81,260,852 (GRCm39) missense probably benign 0.45
R9061:Slc8a3 UTSW 12 81,263,540 (GRCm39) missense probably damaging 0.99
R9267:Slc8a3 UTSW 12 81,361,208 (GRCm39) missense possibly damaging 0.77
R9416:Slc8a3 UTSW 12 81,361,838 (GRCm39) missense probably benign 0.06
R9519:Slc8a3 UTSW 12 81,362,326 (GRCm39) missense probably benign 0.30
R9531:Slc8a3 UTSW 12 81,361,997 (GRCm39) missense probably damaging 1.00
X0026:Slc8a3 UTSW 12 81,362,061 (GRCm39) missense probably benign 0.22
X0028:Slc8a3 UTSW 12 81,361,717 (GRCm39) missense probably damaging 1.00
Z1177:Slc8a3 UTSW 12 81,362,650 (GRCm39) missense probably benign 0.13
Z1177:Slc8a3 UTSW 12 81,361,474 (GRCm39) missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CCTGTGATGAAAGCAAAGTTTGG -3'
(R):5'- AATAGTCTTCCTTTGCCTCGGG -3'

Sequencing Primer
(F):5'- TGAAAGCAAAGTTTGGGATTAACAC -3'
(R):5'- GGCTGTCCTGGCCTCCC -3'
Posted On 2017-07-14