Incidental Mutation 'R6062:Slc8a3'
ID483862
Institutional Source Beutler Lab
Gene Symbol Slc8a3
Ensembl Gene ENSMUSG00000079055
Gene Namesolute carrier family 8 (sodium/calcium exchanger), member 3
SynonymsNcx3
MMRRC Submission 044227-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6062 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location81197915-81333180 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 81314350 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 565 (P565L)
Ref Sequence ENSEMBL: ENSMUSP00000138735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064594] [ENSMUST00000085238] [ENSMUST00000182208]
Predicted Effect probably damaging
Transcript: ENSMUST00000064594
AA Change: P565L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000063258
Gene: ENSMUSG00000079055
AA Change: P565L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 79 250 1.3e-36 PFAM
Pfam:Na_Ca_ex_C 253 379 4.6e-57 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.04e-40 SMART
low complexity region 712 723 N/A INTRINSIC
Pfam:Na_Ca_ex 754 919 2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000085238
AA Change: P565L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082334
Gene: ENSMUSG00000079055
AA Change: P565L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 79 250 1.3e-36 PFAM
Pfam:Na_Ca_ex_C 253 379 4.6e-57 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.54e-43 SMART
low complexity region 705 716 N/A INTRINSIC
Pfam:Na_Ca_ex 747 912 1.9e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182208
AA Change: P565L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138735
Gene: ENSMUSG00000079055
AA Change: P565L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Na_Ca_ex 89 248 8.1e-38 PFAM
Calx_beta 385 485 3.25e-42 SMART
Calx_beta 519 619 1.04e-40 SMART
low complexity region 712 723 N/A INTRINSIC
Pfam:Na_Ca_ex 764 917 9.1e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183102
Meta Mutation Damage Score 0.5949 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium/calcium exchanger integral membrane protein family. Na+/Ca2+ exchange proteins are involved in maintaining Ca2+ homeostasis in a wide variety of cell types. The protein is regulated by intracellular calcium ions and is found in both the plasma membrane and intracellular organellar membranes, where exchange of Na+ for Ca2+ occurs in an electrogenic manner. Alternative splicing has been observed for this gene and multiple variants have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 G T 4: 58,826,453 S1038Y possibly damaging Het
Atat1 T A 17: 35,908,564 Q136L probably damaging Het
Atm A G 9: 53,488,587 L1531P probably damaging Het
Brca2 G A 5: 150,556,889 R2708H probably damaging Het
Cand1 G A 10: 119,218,010 A141V possibly damaging Het
Cdcp2 T C 4: 107,102,492 S35P probably damaging Het
Ces4a G A 8: 105,138,174 probably null Het
Colec10 T A 15: 54,459,807 M142K possibly damaging Het
Crtc1 G T 8: 70,406,189 D90E probably damaging Het
Csmd1 T C 8: 16,092,305 E1528G possibly damaging Het
Csnk2a2 A G 8: 95,457,469 V154A possibly damaging Het
Daglb T C 5: 143,494,603 I454T probably benign Het
Dtna C A 18: 23,622,056 N478K possibly damaging Het
E330034G19Rik A T 14: 24,293,380 probably benign Het
Eefsec A T 6: 88,355,629 S200T probably benign Het
Enthd1 T A 15: 80,452,715 D506V probably damaging Het
Erbb2 A G 11: 98,433,249 Y736C probably damaging Het
Gabrg1 A G 5: 70,780,713 C183R probably damaging Het
Ginm1 T A 10: 7,775,333 H103L probably benign Het
Golgb1 C A 16: 36,914,671 Q1427K possibly damaging Het
Grb14 G T 2: 65,022,620 Q9K possibly damaging Het
Hbp1 A T 12: 31,937,247 M192K probably damaging Het
Herpud2 A T 9: 25,108,988 D357E probably damaging Het
Idi1 A G 13: 8,887,505 S111G probably damaging Het
Lrrc32 T C 7: 98,498,541 V176A probably benign Het
Matn1 T A 4: 130,951,966 D310E probably benign Het
Mbtps1 A T 8: 119,531,091 L469Q possibly damaging Het
Muc4 A G 16: 32,759,308 D2417G unknown Het
Myo7b T C 18: 31,967,990 T1551A possibly damaging Het
Neb A G 2: 52,185,281 M224T probably benign Het
Ola1 A T 2: 73,199,498 D92E probably damaging Het
Olfr1019 T G 2: 85,841,114 I226L probably benign Het
Olfr388-ps1 A C 11: 73,724,560 C155G unknown Het
Olfr723 A T 14: 49,928,662 M294K probably damaging Het
Olfr912 T A 9: 38,539,144 M83K probably damaging Het
Otud4 T C 8: 79,673,896 Y1080H probably damaging Het
Plce1 G A 19: 38,524,751 A165T probably benign Het
Prelid2 T C 18: 41,912,465 I127V probably benign Het
Rab35 A G 5: 115,640,088 I38V probably damaging Het
Rab3d T C 9: 21,910,519 T209A probably benign Het
Rapgef1 A G 2: 29,700,732 E321G probably damaging Het
Rem1 T C 2: 152,628,097 M1T probably null Het
Rgsl1 T C 1: 153,799,872 K181R possibly damaging Het
Scel C A 14: 103,585,136 N395K possibly damaging Het
Sept9 A G 11: 117,290,800 E142G possibly damaging Het
Shcbp1 A C 8: 4,764,905 M191R probably benign Het
Slc22a19 T C 19: 7,674,282 N520S probably damaging Het
Slc28a1 C T 7: 81,115,563 R9* probably null Het
Slc2a7 T C 4: 150,168,427 V508A probably benign Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Tenm3 T G 8: 48,343,406 I455L possibly damaging Het
Tmem267 T C 13: 119,609,231 S141P probably damaging Het
Tnn T A 1: 160,098,278 D1383V probably damaging Het
Usp9y G T Y: 1,454,199 Q23K probably benign Het
Vmn1r46 T C 6: 89,976,259 I30T possibly damaging Het
Zfp382 T C 7: 30,133,590 L222P probably damaging Het
Zfp950 T A 19: 61,120,425 K73N possibly damaging Het
Other mutations in Slc8a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Slc8a3 APN 12 81314569 missense probably benign
IGL01315:Slc8a3 APN 12 81314395 missense probably damaging 0.97
IGL01365:Slc8a3 APN 12 81315376 missense probably damaging 0.99
IGL01610:Slc8a3 APN 12 81315802 missense probably damaging 1.00
IGL02227:Slc8a3 APN 12 81315683 missense probably damaging 1.00
IGL02299:Slc8a3 APN 12 81315224 missense probably damaging 0.98
IGL02548:Slc8a3 APN 12 81204156 splice site probably benign
IGL02646:Slc8a3 APN 12 81315094 missense probably damaging 1.00
IGL03135:Slc8a3 APN 12 81202249 missense probably damaging 1.00
R0050:Slc8a3 UTSW 12 81315265 missense probably damaging 1.00
R0627:Slc8a3 UTSW 12 81314842 missense probably damaging 1.00
R0648:Slc8a3 UTSW 12 81314446 missense probably damaging 1.00
R1342:Slc8a3 UTSW 12 81316016 missense probably damaging 0.99
R1437:Slc8a3 UTSW 12 81315986 missense probably damaging 0.99
R1470:Slc8a3 UTSW 12 81199710 missense probably benign
R1470:Slc8a3 UTSW 12 81199710 missense probably benign
R1557:Slc8a3 UTSW 12 81315557 missense probably damaging 1.00
R1563:Slc8a3 UTSW 12 81205007 missense possibly damaging 0.47
R1918:Slc8a3 UTSW 12 81314844 missense probably damaging 0.99
R1930:Slc8a3 UTSW 12 81314446 missense probably damaging 1.00
R1931:Slc8a3 UTSW 12 81314446 missense probably damaging 1.00
R2232:Slc8a3 UTSW 12 81315220 missense probably damaging 0.99
R2680:Slc8a3 UTSW 12 81202339 missense probably damaging 0.99
R2941:Slc8a3 UTSW 12 81315179 missense probably damaging 1.00
R3157:Slc8a3 UTSW 12 81314992 missense probably damaging 1.00
R3159:Slc8a3 UTSW 12 81314992 missense probably damaging 1.00
R3751:Slc8a3 UTSW 12 81204138 missense probably damaging 1.00
R3859:Slc8a3 UTSW 12 81314872 missense probably damaging 0.99
R4240:Slc8a3 UTSW 12 81315176 missense probably damaging 0.99
R4527:Slc8a3 UTSW 12 81315853 missense probably damaging 1.00
R4547:Slc8a3 UTSW 12 81314851 missense possibly damaging 0.76
R4951:Slc8a3 UTSW 12 81314699 missense probably benign 0.31
R4951:Slc8a3 UTSW 12 81315986 missense probably damaging 0.99
R5022:Slc8a3 UTSW 12 81199558 missense probably damaging 0.96
R5049:Slc8a3 UTSW 12 81214132 missense probably damaging 1.00
R5057:Slc8a3 UTSW 12 81199558 missense probably damaging 0.96
R5104:Slc8a3 UTSW 12 81214134 missense probably null 0.34
R5122:Slc8a3 UTSW 12 81314258 critical splice donor site probably null
R5183:Slc8a3 UTSW 12 81314491 missense possibly damaging 0.79
R5629:Slc8a3 UTSW 12 81199631 missense probably damaging 1.00
R6218:Slc8a3 UTSW 12 81199567 missense probably benign
R6279:Slc8a3 UTSW 12 81314978 missense probably damaging 0.99
R6300:Slc8a3 UTSW 12 81314978 missense probably damaging 0.99
R6416:Slc8a3 UTSW 12 81315627 missense probably damaging 1.00
R6790:Slc8a3 UTSW 12 81314432 missense probably benign 0.00
R6999:Slc8a3 UTSW 12 81314755 missense probably benign 0.06
R7195:Slc8a3 UTSW 12 81314273 missense possibly damaging 0.95
R7268:Slc8a3 UTSW 12 81315053 missense probably damaging 0.98
R7288:Slc8a3 UTSW 12 81216824 missense possibly damaging 0.70
R7383:Slc8a3 UTSW 12 81315805 missense probably damaging 1.00
R7392:Slc8a3 UTSW 12 81314803 missense probably damaging 0.99
R7394:Slc8a3 UTSW 12 81214058 splice site probably null
R7549:Slc8a3 UTSW 12 81314770 missense probably benign 0.06
R7657:Slc8a3 UTSW 12 81314384 missense probably damaging 1.00
R7699:Slc8a3 UTSW 12 81314473 missense probably damaging 1.00
R7759:Slc8a3 UTSW 12 81314551 missense probably benign
R7960:Slc8a3 UTSW 12 81216732 missense probably benign 0.00
R7985:Slc8a3 UTSW 12 81314993 missense probably damaging 1.00
R8059:Slc8a3 UTSW 12 81202258 missense probably damaging 1.00
R8192:Slc8a3 UTSW 12 81199681 missense probably damaging 1.00
R8397:Slc8a3 UTSW 12 81199768 missense probably benign 0.45
R8413:Slc8a3 UTSW 12 81314678 missense probably damaging 0.97
R8681:Slc8a3 UTSW 12 81315140 missense probably benign
X0026:Slc8a3 UTSW 12 81315287 missense probably benign 0.22
X0028:Slc8a3 UTSW 12 81314943 missense probably damaging 1.00
Z1177:Slc8a3 UTSW 12 81314700 missense possibly damaging 0.92
Z1177:Slc8a3 UTSW 12 81315876 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CCTGTGATGAAAGCAAAGTTTGG -3'
(R):5'- AATAGTCTTCCTTTGCCTCGGG -3'

Sequencing Primer
(F):5'- TGAAAGCAAAGTTTGGGATTAACAC -3'
(R):5'- GGCTGTCCTGGCCTCCC -3'
Posted On2017-07-14