Incidental Mutation 'R6062:Idi1'
ID483863
Institutional Source Beutler Lab
Gene Symbol Idi1
Ensembl Gene ENSMUSG00000058258
Gene Nameisopentenyl-diphosphate delta isomerase
Synonyms
MMRRC Submission 044227-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6062 (G1)
Quality Score208.009
Status Validated
Chromosome13
Chromosomal Location8885501-8892451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 8887505 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 111 (S111G)
Ref Sequence ENSEMBL: ENSMUSP00000132780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169314]
Predicted Effect probably damaging
Transcript: ENSMUST00000169314
AA Change: S111G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132780
Gene: ENSMUSG00000058258
AA Change: S111G

DomainStartEndE-ValueType
Pfam:NUDIX 106 256 1.2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176851
Predicted Effect unknown
Transcript: ENSMUST00000177397
AA Change: S83G
Predicted Effect unknown
Transcript: ENSMUST00000177400
AA Change: S66G
Predicted Effect unknown
Transcript: ENSMUST00000177447
AA Change: S66G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221551
Meta Mutation Damage Score 0.8445 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IDI1 encodes a peroxisomally-localized enzyme that catalyzes the interconversion of isopentenyl diphosphate (IPP) to its highly electrophilic isomer, dimethylallyl diphosphate (DMAPP), which are the substrates for the successive reaction that results in the synthesis of farnesyl diphosphate and, ultimately, cholesterol. It has been shown in peroxisomal deficiency diseases such as Zellweger syndrome and neonatal adrenoleukodystrophy that there is reduction in IPP isomerase activity. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 G T 4: 58,826,453 S1038Y possibly damaging Het
Atat1 T A 17: 35,908,564 Q136L probably damaging Het
Atm A G 9: 53,488,587 L1531P probably damaging Het
Brca2 G A 5: 150,556,889 R2708H probably damaging Het
Cand1 G A 10: 119,218,010 A141V possibly damaging Het
Cdcp2 T C 4: 107,102,492 S35P probably damaging Het
Ces4a G A 8: 105,138,174 probably null Het
Colec10 T A 15: 54,459,807 M142K possibly damaging Het
Crtc1 G T 8: 70,406,189 D90E probably damaging Het
Csmd1 T C 8: 16,092,305 E1528G possibly damaging Het
Csnk2a2 A G 8: 95,457,469 V154A possibly damaging Het
Daglb T C 5: 143,494,603 I454T probably benign Het
Dtna C A 18: 23,622,056 N478K possibly damaging Het
E330034G19Rik A T 14: 24,293,380 probably benign Het
Eefsec A T 6: 88,355,629 S200T probably benign Het
Enthd1 T A 15: 80,452,715 D506V probably damaging Het
Erbb2 A G 11: 98,433,249 Y736C probably damaging Het
Gabrg1 A G 5: 70,780,713 C183R probably damaging Het
Ginm1 T A 10: 7,775,333 H103L probably benign Het
Golgb1 C A 16: 36,914,671 Q1427K possibly damaging Het
Grb14 G T 2: 65,022,620 Q9K possibly damaging Het
Hbp1 A T 12: 31,937,247 M192K probably damaging Het
Herpud2 A T 9: 25,108,988 D357E probably damaging Het
Lrrc32 T C 7: 98,498,541 V176A probably benign Het
Matn1 T A 4: 130,951,966 D310E probably benign Het
Mbtps1 A T 8: 119,531,091 L469Q possibly damaging Het
Muc4 A G 16: 32,759,308 D2417G unknown Het
Myo7b T C 18: 31,967,990 T1551A possibly damaging Het
Neb A G 2: 52,185,281 M224T probably benign Het
Ola1 A T 2: 73,199,498 D92E probably damaging Het
Olfr1019 T G 2: 85,841,114 I226L probably benign Het
Olfr388-ps1 A C 11: 73,724,560 C155G unknown Het
Olfr723 A T 14: 49,928,662 M294K probably damaging Het
Olfr912 T A 9: 38,539,144 M83K probably damaging Het
Otud4 T C 8: 79,673,896 Y1080H probably damaging Het
Plce1 G A 19: 38,524,751 A165T probably benign Het
Prelid2 T C 18: 41,912,465 I127V probably benign Het
Rab35 A G 5: 115,640,088 I38V probably damaging Het
Rab3d T C 9: 21,910,519 T209A probably benign Het
Rapgef1 A G 2: 29,700,732 E321G probably damaging Het
Rem1 T C 2: 152,628,097 M1T probably null Het
Rgsl1 T C 1: 153,799,872 K181R possibly damaging Het
Scel C A 14: 103,585,136 N395K possibly damaging Het
Sept9 A G 11: 117,290,800 E142G possibly damaging Het
Shcbp1 A C 8: 4,764,905 M191R probably benign Het
Slc22a19 T C 19: 7,674,282 N520S probably damaging Het
Slc28a1 C T 7: 81,115,563 R9* probably null Het
Slc2a7 T C 4: 150,168,427 V508A probably benign Het
Slc8a3 G A 12: 81,314,350 P565L probably damaging Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Tenm3 T G 8: 48,343,406 I455L possibly damaging Het
Tmem267 T C 13: 119,609,231 S141P probably damaging Het
Tnn T A 1: 160,098,278 D1383V probably damaging Het
Usp9y G T Y: 1,454,199 Q23K probably benign Het
Vmn1r46 T C 6: 89,976,259 I30T possibly damaging Het
Zfp382 T C 7: 30,133,590 L222P probably damaging Het
Zfp950 T A 19: 61,120,425 K73N possibly damaging Het
Other mutations in Idi1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01465:Idi1 APN 13 8890379 missense probably benign 0.12
R0304:Idi1 UTSW 13 8890357 missense probably damaging 1.00
R1535:Idi1 UTSW 13 8886909 splice site probably benign
R1739:Idi1 UTSW 13 8890411 missense probably benign 0.05
R3854:Idi1 UTSW 13 8885932 missense probably benign 0.05
R3855:Idi1 UTSW 13 8885932 missense probably benign 0.05
R3856:Idi1 UTSW 13 8885932 missense probably benign 0.05
R4463:Idi1 UTSW 13 8887472 splice site probably benign
R5049:Idi1 UTSW 13 8888042 missense probably damaging 1.00
R5081:Idi1 UTSW 13 8887927 nonsense probably null
R6082:Idi1 UTSW 13 8890470 nonsense probably null
R7261:Idi1 UTSW 13 8886895 missense probably benign 0.31
R7956:Idi1 UTSW 13 8887960 missense possibly damaging 0.93
R8017:Idi1 UTSW 13 8887938 missense probably benign 0.29
Z1177:Idi1 UTSW 13 8888019 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATAGTTCTCAAGTCTGTCTTTCAG -3'
(R):5'- ATACAAGTGAAGCCGTGTGC -3'

Sequencing Primer
(F):5'- CAAATGGTCTGGGTTCAGCCAC -3'
(R):5'- CCGTGTGCCTGGCTGATTC -3'
Posted On2017-07-14