Mutagenetix > Incidental Mutation

Incidental Mutation 'R6062:Scel'

483867

Institutional Source

Beutler Lab

Gene Symbol

Scel

Ensembl Gene

ENSMUSG00000022123

Gene Name

sciellin

Synonyms

9230114I02Rik

MMRRC Submission

044227-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6062 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

103513342-103612797 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 103585136 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 395 (N395K)

Ref Sequence

ENSEMBL: ENSMUSP00000093233 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095576] [ENSMUST00000227322]

AlphaFold

Q9EQG3

Predicted Effect

possibly damaging
Transcript: ENSMUST00000095576
AA Change: N395K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000093233
Gene: ENSMUSG00000022123
AA Change: N395K

Domain	Start	End	E-Value	Type
low complexity region	111	131	N/A	INTRINSIC
low complexity region	159	178	N/A	INTRINSIC
internal_repeat_1	204	327	9.24e-7	PROSPERO
internal_repeat_1	378	505	9.24e-7	PROSPERO
low complexity region	525	537	N/A	INTRINSIC
LIM	584	642	2.23e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000227322
AA Change: N375K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

Meta Mutation Damage Score

0.0721

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.9%

Validation Efficiency

98% (56/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a precursor to the cornified envelope of terminally differentiated keratinocytes. This protein localizes to the periphery of cells and may function in the assembly or regulation of proteins in the cornified envelope. Transcript variants encoding different isoforms exist. A transcript variant utilizing an alternative polyA signal has been described in the literature, but its full-length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and fertile with normal hair morphology and development and normal skin morphology and barrier function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AI314180	G	T	4: 58,826,453	S1038Y	possibly damaging	Het
Atat1	T	A	17: 35,908,564	Q136L	probably damaging	Het
Atm	A	G	9: 53,488,587	L1531P	probably damaging	Het
Brca2	G	A	5: 150,556,889	R2708H	probably damaging	Het
Cand1	G	A	10: 119,218,010	A141V	possibly damaging	Het
Cdcp2	T	C	4: 107,102,492	S35P	probably damaging	Het
Ces4a	G	A	8: 105,138,174		probably null	Het
Colec10	T	A	15: 54,459,807	M142K	possibly damaging	Het
Crtc1	G	T	8: 70,406,189	D90E	probably damaging	Het
Csmd1	T	C	8: 16,092,305	E1528G	possibly damaging	Het
Csnk2a2	A	G	8: 95,457,469	V154A	possibly damaging	Het
Daglb	T	C	5: 143,494,603	I454T	probably benign	Het
Dtna	C	A	18: 23,622,056	N478K	possibly damaging	Het
E330034G19Rik	A	T	14: 24,293,380		probably benign	Het
Eefsec	A	T	6: 88,355,629	S200T	probably benign	Het
Enthd1	T	A	15: 80,452,715	D506V	probably damaging	Het
Erbb2	A	G	11: 98,433,249	Y736C	probably damaging	Het
Gabrg1	A	G	5: 70,780,713	C183R	probably damaging	Het
Ginm1	T	A	10: 7,775,333	H103L	probably benign	Het
Golgb1	C	A	16: 36,914,671	Q1427K	possibly damaging	Het
Grb14	G	T	2: 65,022,620	Q9K	possibly damaging	Het
Hbp1	A	T	12: 31,937,247	M192K	probably damaging	Het
Herpud2	A	T	9: 25,108,988	D357E	probably damaging	Het
Idi1	A	G	13: 8,887,505	S111G	probably damaging	Het
Lrrc32	T	C	7: 98,498,541	V176A	probably benign	Het
Matn1	T	A	4: 130,951,966	D310E	probably benign	Het
Mbtps1	A	T	8: 119,531,091	L469Q	possibly damaging	Het
Muc4	A	G	16: 32,759,308	D2417G	unknown	Het
Myo7b	T	C	18: 31,967,990	T1551A	possibly damaging	Het
Neb	A	G	2: 52,185,281	M224T	probably benign	Het
Ola1	A	T	2: 73,199,498	D92E	probably damaging	Het
Olfr1019	T	G	2: 85,841,114	I226L	probably benign	Het
Olfr388-ps1	A	C	11: 73,724,560	C155G	unknown	Het
Olfr723	A	T	14: 49,928,662	M294K	probably damaging	Het
Olfr912	T	A	9: 38,539,144	M83K	probably damaging	Het
Otud4	T	C	8: 79,673,896	Y1080H	probably damaging	Het
Plce1	G	A	19: 38,524,751	A165T	probably benign	Het
Prelid2	T	C	18: 41,912,465	I127V	probably benign	Het
Rab35	A	G	5: 115,640,088	I38V	probably damaging	Het
Rab3d	T	C	9: 21,910,519	T209A	probably benign	Het
Rapgef1	A	G	2: 29,700,732	E321G	probably damaging	Het
Rem1	T	C	2: 152,628,097	M1T	probably null	Het
Rgsl1	T	C	1: 153,799,872	K181R	possibly damaging	Het
Sept9	A	G	11: 117,290,800	E142G	possibly damaging	Het
Shcbp1	A	C	8: 4,764,905	M191R	probably benign	Het
Slc22a19	T	C	19: 7,674,282	N520S	probably damaging	Het
Slc28a1	C	T	7: 81,115,563	R9*	probably null	Het
Slc2a7	T	C	4: 150,168,427	V508A	probably benign	Het
Slc8a3	G	A	12: 81,314,350	P565L	probably damaging	Het
Svil	T	G	18: 5,106,724	V1855G	probably damaging	Het
Tenm3	T	G	8: 48,343,406	I455L	possibly damaging	Het
Tmem267	T	C	13: 119,609,231	S141P	probably damaging	Het
Tnn	T	A	1: 160,098,278	D1383V	probably damaging	Het
Usp9y	G	T	Y: 1,454,199	Q23K	probably benign	Het
Vmn1r46	T	C	6: 89,976,259	I30T	possibly damaging	Het
Zfp382	T	C	7: 30,133,590	L222P	probably damaging	Het
Zfp950	T	A	19: 61,120,425	K73N	possibly damaging	Het

Other mutations in Scel

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00841:Scel	APN	14	103529995	missense	probably benign	0.01
IGL00913:Scel	APN	14	103581809	missense	probably benign	0.35
IGL01086:Scel	APN	14	103612391	missense	probably benign	0.05
IGL01352:Scel	APN	14	103533338	missense	possibly damaging	0.54
IGL01396:Scel	APN	14	103608094	splice site	probably benign
IGL01954:Scel	APN	14	103603242	splice site	probably benign
IGL02064:Scel	APN	14	103533326	missense	probably damaging	0.98
IGL02186:Scel	APN	14	103564821	missense	probably benign	0.23
IGL02475:Scel	APN	14	103537008	missense	possibly damaging	0.95
IGL02926:Scel	APN	14	103576247	nonsense	probably null
IGL03122:Scel	APN	14	103599406	missense	possibly damaging	0.66
IGL03135:Scel	APN	14	103586514	missense	probably benign	0.02
PIT4585001:Scel	UTSW	14	103592368	missense	possibly damaging	0.90
R0346:Scel	UTSW	14	103529984	missense	probably damaging	1.00
R0394:Scel	UTSW	14	103562518	missense	probably benign	0.15
R0418:Scel	UTSW	14	103603254	missense	probably benign
R0635:Scel	UTSW	14	103583139	critical splice donor site	probably null
R0815:Scel	UTSW	14	103586480	missense	possibly damaging	0.83
R0863:Scel	UTSW	14	103586480	missense	possibly damaging	0.83
R0990:Scel	UTSW	14	103581832	missense	possibly damaging	0.55
R1084:Scel	UTSW	14	103564843	critical splice donor site	probably null
R1641:Scel	UTSW	14	103533316	missense	probably damaging	1.00
R2001:Scel	UTSW	14	103610790	missense	possibly damaging	0.66
R2002:Scel	UTSW	14	103541985	missense	probably damaging	1.00
R2341:Scel	UTSW	14	103608170	missense	possibly damaging	0.92
R3425:Scel	UTSW	14	103608106	missense	possibly damaging	0.92
R3836:Scel	UTSW	14	103592386	missense	possibly damaging	0.66
R4035:Scel	UTSW	14	103530004	missense	probably damaging	1.00
R4197:Scel	UTSW	14	103599400	missense	probably damaging	0.97
R4737:Scel	UTSW	14	103572037	missense	possibly damaging	0.79
R4801:Scel	UTSW	14	103583100	missense	probably benign	0.01
R4802:Scel	UTSW	14	103583100	missense	probably benign	0.01
R5369:Scel	UTSW	14	103586493	missense	probably benign	0.00
R5555:Scel	UTSW	14	103602206	missense	probably benign	0.27
R5582:Scel	UTSW	14	103583139	critical splice donor site	probably benign
R5931:Scel	UTSW	14	103605624	nonsense	probably null
R5978:Scel	UTSW	14	103529254	splice site	probably null
R6045:Scel	UTSW	14	103592213	missense	probably benign	0.12
R6218:Scel	UTSW	14	103572042	missense	probably benign	0.12
R6225:Scel	UTSW	14	103591984	missense	probably benign	0.27
R7102:Scel	UTSW	14	103543832	nonsense	probably null
R7349:Scel	UTSW	14	103543879	missense	probably benign	0.11
R8376:Scel	UTSW	14	103572015	missense	probably benign	0.02
R8924:Scel	UTSW	14	103592371	missense	possibly damaging	0.66
R9014:Scel	UTSW	14	103585139	missense	probably benign
R9130:Scel	UTSW	14	103533310	missense	probably benign	0.05
R9135:Scel	UTSW	14	103602190	missense	probably benign
R9179:Scel	UTSW	14	103574400	missense	possibly damaging	0.79
R9614:Scel	UTSW	14	103605596	missense	probably damaging	1.00
R9638:Scel	UTSW	14	103541973	missense	possibly damaging	0.89
R9672:Scel	UTSW	14	103599402	missense	possibly damaging	0.82
R9719:Scel	UTSW	14	103572006	critical splice acceptor site	probably null
X0026:Scel	UTSW	14	103591993	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- AAGAGGATTCAAGTCATGCTGG -3'
(R):5'- TCGTGTATGATTATGGTGTCACAAG -3'

Sequencing Primer
(F):5'- CAAGTCATGCTGGAGTTTTGAATTAC -3'
(R):5'- GGTGTCACAAGAAATTTCTCAAGTAG -3'

Posted On

2017-07-14