Incidental Mutation 'R6062:Dtna'
ID 483874
Institutional Source Beutler Lab
Gene Symbol Dtna
Ensembl Gene ENSMUSG00000024302
Gene Name dystrobrevin alpha
Synonyms a-DB-1, A0, alpha-dystrobrevin, 2210407P21Rik, 87K protein, Dtn, adbn
MMRRC Submission 044227-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.207) question?
Stock # R6062 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 23548192-23792772 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 23755113 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 478 (N478K)
Ref Sequence ENSEMBL: ENSMUSP00000152288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115832] [ENSMUST00000220904] [ENSMUST00000221880]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000115832
AA Change: N421K

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000111498
Gene: ENSMUSG00000024302
AA Change: N421K

DomainStartEndE-ValueType
Pfam:EF-hand_2 16 140 1.7e-37 PFAM
Pfam:EF-hand_3 144 232 1.6e-32 PFAM
ZnF_ZZ 237 282 1.29e-17 SMART
SCOP:d1eq1a_ 361 494 5e-3 SMART
low complexity region 499 514 N/A INTRINSIC
coiled coil region 650 677 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000220904
AA Change: N478K

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000221880
AA Change: N478K

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.0614 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency 98% (56/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dystrobrevin subfamily of the dystrophin family. This protein is a component of the dystrophin-associated protein complex (DPC), which consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and alpha- and beta-dystrobrevin. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Mutations in this gene are associated with left ventricular noncompaction with congenital heart defects. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted mutants exhibit skeletal and cardiac myopathies. Neuromuscular junctions appear to form normally, but their postnatal maturation is compromised. Dtna mutations do not increase the severity of Dmd or Utrn mutants whose products are also part of the dystrophin-glycoprotein complex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atat1 T A 17: 36,219,456 (GRCm39) Q136L probably damaging Het
Atm A G 9: 53,399,887 (GRCm39) L1531P probably damaging Het
Brca2 G A 5: 150,480,354 (GRCm39) R2708H probably damaging Het
Cand1 G A 10: 119,053,915 (GRCm39) A141V possibly damaging Het
Cdcp2 T C 4: 106,959,689 (GRCm39) S35P probably damaging Het
Ces4a G A 8: 105,864,806 (GRCm39) probably null Het
Colec10 T A 15: 54,323,203 (GRCm39) M142K possibly damaging Het
Crtc1 G T 8: 70,858,839 (GRCm39) D90E probably damaging Het
Csmd1 T C 8: 16,142,319 (GRCm39) E1528G possibly damaging Het
Csnk2a2 A G 8: 96,184,097 (GRCm39) V154A possibly damaging Het
Daglb T C 5: 143,480,358 (GRCm39) I454T probably benign Het
E330034G19Rik A T 14: 24,343,448 (GRCm39) probably benign Het
Ecpas G T 4: 58,826,453 (GRCm39) S1038Y possibly damaging Het
Eefsec A T 6: 88,332,611 (GRCm39) S200T probably benign Het
Enthd1 T A 15: 80,336,916 (GRCm39) D506V probably damaging Het
Erbb2 A G 11: 98,324,075 (GRCm39) Y736C probably damaging Het
Gabrg1 A G 5: 70,938,056 (GRCm39) C183R probably damaging Het
Ginm1 T A 10: 7,651,097 (GRCm39) H103L probably benign Het
Golgb1 C A 16: 36,735,033 (GRCm39) Q1427K possibly damaging Het
Grb14 G T 2: 64,852,964 (GRCm39) Q9K possibly damaging Het
Hbp1 A T 12: 31,987,246 (GRCm39) M192K probably damaging Het
Herpud2 A T 9: 25,020,284 (GRCm39) D357E probably damaging Het
Idi1 A G 13: 8,937,541 (GRCm39) S111G probably damaging Het
Lrrc32 T C 7: 98,147,748 (GRCm39) V176A probably benign Het
Matn1 T A 4: 130,679,277 (GRCm39) D310E probably benign Het
Mbtps1 A T 8: 120,257,830 (GRCm39) L469Q possibly damaging Het
Muc4 A G 16: 32,579,682 (GRCm39) D2417G unknown Het
Myo7b T C 18: 32,101,043 (GRCm39) T1551A possibly damaging Het
Neb A G 2: 52,075,293 (GRCm39) M224T probably benign Het
Ola1 A T 2: 73,029,842 (GRCm39) D92E probably damaging Het
Or1e28-ps1 A C 11: 73,615,386 (GRCm39) C155G unknown Het
Or4l1 A T 14: 50,166,119 (GRCm39) M294K probably damaging Het
Or5ar1 T G 2: 85,671,458 (GRCm39) I226L probably benign Het
Or8b48 T A 9: 38,450,440 (GRCm39) M83K probably damaging Het
Otud4 T C 8: 80,400,525 (GRCm39) Y1080H probably damaging Het
Plce1 G A 19: 38,513,195 (GRCm39) A165T probably benign Het
Prelid2 T C 18: 42,045,530 (GRCm39) I127V probably benign Het
Rab35 A G 5: 115,778,147 (GRCm39) I38V probably damaging Het
Rab3d T C 9: 21,821,815 (GRCm39) T209A probably benign Het
Rapgef1 A G 2: 29,590,744 (GRCm39) E321G probably damaging Het
Rem1 T C 2: 152,470,017 (GRCm39) M1T probably null Het
Rgsl1 T C 1: 153,675,618 (GRCm39) K181R possibly damaging Het
Scel C A 14: 103,822,572 (GRCm39) N395K possibly damaging Het
Septin9 A G 11: 117,181,626 (GRCm39) E142G possibly damaging Het
Shcbp1 A C 8: 4,814,905 (GRCm39) M191R probably benign Het
Slc22a19 T C 19: 7,651,647 (GRCm39) N520S probably damaging Het
Slc28a1 C T 7: 80,765,311 (GRCm39) R9* probably null Het
Slc2a7 T C 4: 150,252,884 (GRCm39) V508A probably benign Het
Slc8a3 G A 12: 81,361,124 (GRCm39) P565L probably damaging Het
Svil T G 18: 5,106,724 (GRCm39) V1855G probably damaging Het
Tenm3 T G 8: 48,796,441 (GRCm39) I455L possibly damaging Het
Tmem267 T C 13: 120,070,767 (GRCm39) S141P probably damaging Het
Tnn T A 1: 159,925,848 (GRCm39) D1383V probably damaging Het
Usp9y G T Y: 1,454,199 (GRCm39) Q23K probably benign Het
Vmn1r46 T C 6: 89,953,241 (GRCm39) I30T possibly damaging Het
Zfp382 T C 7: 29,833,015 (GRCm39) L222P probably damaging Het
Zfp950 T A 19: 61,108,863 (GRCm39) K73N possibly damaging Het
Other mutations in Dtna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Dtna APN 18 23,730,545 (GRCm39) missense probably benign 0.22
IGL01620:Dtna APN 18 23,758,144 (GRCm39) missense probably damaging 1.00
IGL01705:Dtna APN 18 23,678,788 (GRCm39) missense probably damaging 1.00
IGL01914:Dtna APN 18 23,730,516 (GRCm39) missense possibly damaging 0.62
IGL02388:Dtna APN 18 23,730,571 (GRCm39) missense probably benign 0.00
IGL02427:Dtna APN 18 23,784,595 (GRCm39) missense possibly damaging 0.95
IGL03074:Dtna APN 18 23,735,662 (GRCm39) missense possibly damaging 0.74
R0041:Dtna UTSW 18 23,779,932 (GRCm39) unclassified probably benign
R0041:Dtna UTSW 18 23,779,932 (GRCm39) unclassified probably benign
R0078:Dtna UTSW 18 23,754,499 (GRCm39) missense probably damaging 1.00
R0390:Dtna UTSW 18 23,730,558 (GRCm39) missense probably damaging 1.00
R1808:Dtna UTSW 18 23,702,697 (GRCm39) missense probably damaging 1.00
R1872:Dtna UTSW 18 23,730,617 (GRCm39) critical splice donor site probably null
R2095:Dtna UTSW 18 23,702,805 (GRCm39) missense probably damaging 1.00
R2216:Dtna UTSW 18 23,702,622 (GRCm39) missense probably damaging 1.00
R2295:Dtna UTSW 18 23,764,469 (GRCm39) missense probably damaging 1.00
R2402:Dtna UTSW 18 23,728,535 (GRCm39) nonsense probably null
R2846:Dtna UTSW 18 23,784,560 (GRCm39) splice site probably null
R3836:Dtna UTSW 18 23,758,159 (GRCm39) missense probably damaging 1.00
R4764:Dtna UTSW 18 23,668,206 (GRCm39) splice site probably null
R4893:Dtna UTSW 18 23,702,724 (GRCm39) missense probably damaging 0.99
R5194:Dtna UTSW 18 23,723,302 (GRCm39) nonsense probably null
R5373:Dtna UTSW 18 23,784,670 (GRCm39) missense probably damaging 1.00
R5374:Dtna UTSW 18 23,784,670 (GRCm39) missense probably damaging 1.00
R5526:Dtna UTSW 18 23,779,287 (GRCm39) missense probably damaging 0.99
R5755:Dtna UTSW 18 23,754,520 (GRCm39) missense probably benign
R5769:Dtna UTSW 18 23,784,611 (GRCm39) missense probably benign 0.27
R6413:Dtna UTSW 18 23,755,071 (GRCm39) missense probably damaging 1.00
R6876:Dtna UTSW 18 23,744,167 (GRCm39) missense probably benign 0.00
R7103:Dtna UTSW 18 23,786,436 (GRCm39) critical splice donor site probably null
R7711:Dtna UTSW 18 23,758,253 (GRCm39) critical splice donor site probably null
R7804:Dtna UTSW 18 23,728,666 (GRCm39) missense probably damaging 0.97
R8156:Dtna UTSW 18 23,723,388 (GRCm39) nonsense probably null
R8437:Dtna UTSW 18 23,723,398 (GRCm39) nonsense probably null
R8786:Dtna UTSW 18 23,716,190 (GRCm39) missense probably benign 0.10
R9038:Dtna UTSW 18 23,743,553 (GRCm39) missense probably benign
R9268:Dtna UTSW 18 23,702,643 (GRCm39) missense possibly damaging 0.93
R9416:Dtna UTSW 18 23,780,112 (GRCm39) critical splice donor site probably null
R9578:Dtna UTSW 18 23,728,612 (GRCm39) missense probably damaging 0.98
R9605:Dtna UTSW 18 23,764,454 (GRCm39) missense probably damaging 1.00
R9638:Dtna UTSW 18 23,744,122 (GRCm39) missense probably benign
X0063:Dtna UTSW 18 23,776,225 (GRCm39) missense probably damaging 0.98
X0066:Dtna UTSW 18 23,726,038 (GRCm39) missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- CCCCTCCCATGGAATAGTTC -3'
(R):5'- AAAGCAAAGGCCAGTCTTCCG -3'

Sequencing Primer
(F):5'- GAATAGTTCCTTCTTCCCTGTCTG -3'
(R):5'- CTGTCATTCAGAAGCTTGGC -3'
Posted On 2017-07-14