Incidental Mutation 'R6063:Intu'
ID 483892
Institutional Source Beutler Lab
Gene Symbol Intu
Ensembl Gene ENSMUSG00000060798
Gene Name inturned planar cell polarity protein
Synonyms Pdzk6, 9230116I04Rik, Pdzd6, 9430087H23Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6063 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 40585559-40659206 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 40608524 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 161 (A161T)
Ref Sequence ENSEMBL: ENSMUSP00000054313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061590] [ENSMUST00000091186]
AlphaFold Q059U7
Predicted Effect probably damaging
Transcript: ENSMUST00000061590
AA Change: A161T

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054313
Gene: ENSMUSG00000060798
AA Change: A161T

DomainStartEndE-ValueType
low complexity region 46 63 N/A INTRINSIC
Blast:PDZ 134 214 2e-25 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000091186
AA Change: A179T

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000088725
Gene: ENSMUSG00000060798
AA Change: A179T

DomainStartEndE-ValueType
low complexity region 21 48 N/A INTRINSIC
low complexity region 64 81 N/A INTRINSIC
PDZ 187 269 2.09e-3 SMART
low complexity region 459 468 N/A INTRINSIC
low complexity region 774 784 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161930
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice show defective ciliogenesis and neural tube closure, abnormal patterning of the CNS and limbs, polydactyly, edema and death by E16.5. Homozygotes for a hypomorphic allele show defective ciliation and endochondral ossification, stunted growth, polydactyly and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,483,318 (GRCm39) R1713C unknown Het
Ano6 C T 15: 95,846,298 (GRCm39) T512I probably damaging Het
Ap3s1 T C 18: 46,887,505 (GRCm39) V46A probably benign Het
Art2a C A 7: 101,204,413 (GRCm39) V42F probably damaging Het
Asph C T 4: 9,531,960 (GRCm39) V386M probably benign Het
B4galnt4 T A 7: 140,644,643 (GRCm39) D179E probably benign Het
Bbx T C 16: 50,071,730 (GRCm39) I232V probably benign Het
C1ql2 A G 1: 120,269,321 (GRCm39) I159V probably benign Het
Ccar1 A G 10: 62,612,496 (GRCm39) V223A possibly damaging Het
Cd2ap A T 17: 43,136,802 (GRCm39) L277I probably benign Het
Cfap44 G A 16: 44,250,255 (GRCm39) E778K probably benign Het
Chd3 A T 11: 69,240,063 (GRCm39) D1626E probably benign Het
Crocc C T 4: 140,769,032 (GRCm39) G505S probably benign Het
Crocc T A 4: 140,773,851 (GRCm39) Q72L probably damaging Het
Drosha T C 15: 12,834,156 (GRCm39) probably benign Het
Eps8l1 T A 7: 4,474,296 (GRCm39) S256T possibly damaging Het
F830045P16Rik A G 2: 129,316,310 (GRCm39) V133A probably damaging Het
Fermt2 A T 14: 45,697,338 (GRCm39) M671K possibly damaging Het
Fhdc1 G A 3: 84,353,336 (GRCm39) L630F probably benign Het
Gon4l T C 3: 88,807,306 (GRCm39) S1667P probably damaging Het
Greb1l A C 18: 10,557,340 (GRCm39) K1780T probably damaging Het
H2-Q10 C T 17: 35,781,026 (GRCm39) T8M probably benign Het
Hmcn2 A T 2: 31,324,725 (GRCm39) T4215S probably benign Het
I0C0044D17Rik G A 4: 98,708,576 (GRCm39) probably benign Het
Ifi204 A G 1: 173,579,223 (GRCm39) F541L probably benign Het
Igkv6-17 C T 6: 70,348,764 (GRCm39) A45V probably damaging Het
Kcnmb2 A G 3: 32,233,141 (GRCm39) Y73C probably damaging Het
Lrit1 T C 14: 36,776,945 (GRCm39) F22L probably benign Het
Lrp1b A T 2: 41,174,156 (GRCm39) C699* probably null Het
Lrrc8d A G 5: 105,959,992 (GRCm39) D134G probably benign Het
Map1b T C 13: 99,567,645 (GRCm39) D1692G unknown Het
Met C T 6: 17,491,967 (GRCm39) S243F probably damaging Het
Mlph C A 1: 90,855,882 (GRCm39) H96Q probably damaging Het
Mycbp2 A T 14: 103,372,582 (GRCm39) V4088D probably damaging Het
Nampt T A 12: 32,898,658 (GRCm39) S425T probably damaging Het
Nts G A 10: 102,320,856 (GRCm39) H78Y probably benign Het
Nxf1 A G 19: 8,745,151 (GRCm39) E467G possibly damaging Het
Olfml2a C A 2: 38,841,155 (GRCm39) D230E probably benign Het
Or4b13 C A 2: 90,082,771 (GRCm39) C187F probably benign Het
Or52n2c C T 7: 104,574,599 (GRCm39) R124H probably benign Het
Pcsk5 A G 19: 17,432,045 (GRCm39) probably null Het
Pde5a C A 3: 122,618,574 (GRCm39) T629K probably benign Het
Plcb3 G T 19: 6,940,202 (GRCm39) R462S possibly damaging Het
Pnpla6 T A 8: 3,574,156 (GRCm39) M469K probably benign Het
Pram1 A T 17: 33,860,386 (GRCm39) K318* probably null Het
Prkd1 T C 12: 50,388,826 (GRCm39) R906G probably benign Het
Ptprh T A 7: 4,576,361 (GRCm39) T300S possibly damaging Het
Rdh16f2 A G 10: 127,712,743 (GRCm39) Y247C probably benign Het
Rimbp3 A G 16: 17,028,781 (GRCm39) E735G probably damaging Het
Sall3 G A 18: 81,017,470 (GRCm39) P153S possibly damaging Het
Samd4b T A 7: 28,123,056 (GRCm39) M1L possibly damaging Het
Septin12 T C 16: 4,810,127 (GRCm39) E136G probably damaging Het
Shpk A T 11: 73,104,270 (GRCm39) K140* probably null Het
Sidt1 G T 16: 44,079,829 (GRCm39) F608L probably benign Het
Skint5 A G 4: 113,347,842 (GRCm39) Y1300H probably benign Het
Slc22a28 G A 19: 8,094,386 (GRCm39) P212S probably benign Het
Slc22a5 A T 11: 53,758,359 (GRCm39) F480L possibly damaging Het
Slc35e2 C T 4: 155,694,483 (GRCm39) P10L probably benign Het
Slc3a1 C T 17: 85,335,951 (GRCm39) P31L probably benign Het
Slc4a7 T C 14: 14,793,964 (GRCm38) V1074A possibly damaging Het
Snx2 C T 18: 53,342,697 (GRCm39) Q254* probably null Het
Sox30 G A 11: 45,882,769 (GRCm39) V600I probably benign Het
Svil T G 18: 5,106,724 (GRCm39) V1855G probably damaging Het
Tdpoz9 A G 3: 93,957,408 (GRCm39) F7L probably benign Het
Tdrd7 A G 4: 46,005,486 (GRCm39) T431A probably benign Het
Tenm2 A T 11: 36,054,544 (GRCm39) probably null Het
Tigar A G 6: 127,068,164 (GRCm39) S85P probably benign Het
Tnr A C 1: 159,740,254 (GRCm39) M1143L probably benign Het
Trio G T 15: 27,891,465 (GRCm39) Q429K possibly damaging Het
Urb1 T C 16: 90,585,985 (GRCm39) I452M probably benign Het
Uroc1 A T 6: 90,324,910 (GRCm39) E461V probably benign Het
Vax1 C A 19: 59,157,036 (GRCm39) R99L unknown Het
Xab2 A T 8: 3,663,051 (GRCm39) I510N possibly damaging Het
Zbtb34 A T 2: 33,301,842 (GRCm39) I233K possibly damaging Het
Zbtb47 A G 9: 121,592,598 (GRCm39) E306G probably benign Het
Zfp27 A G 7: 29,593,727 (GRCm39) F746S probably damaging Het
Zfp719 C T 7: 43,239,050 (GRCm39) Q213* probably null Het
Zswim6 T C 13: 107,865,112 (GRCm39) noncoding transcript Het
Other mutations in Intu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01292:Intu APN 3 40,618,696 (GRCm39) missense probably benign 0.12
IGL01386:Intu APN 3 40,647,017 (GRCm39) missense probably damaging 1.00
IGL02645:Intu APN 3 40,655,702 (GRCm39) missense probably benign 0.01
IGL02869:Intu APN 3 40,642,216 (GRCm39) missense probably damaging 1.00
IGL03263:Intu APN 3 40,627,027 (GRCm39) nonsense probably null
H8562:Intu UTSW 3 40,647,103 (GRCm39) missense probably damaging 1.00
PIT4495001:Intu UTSW 3 40,652,033 (GRCm39) missense probably benign 0.07
R0010:Intu UTSW 3 40,608,702 (GRCm39) intron probably benign
R0173:Intu UTSW 3 40,629,776 (GRCm39) critical splice donor site probably null
R0426:Intu UTSW 3 40,629,735 (GRCm39) missense probably damaging 0.97
R1566:Intu UTSW 3 40,647,008 (GRCm39) missense probably damaging 0.99
R1619:Intu UTSW 3 40,652,061 (GRCm39) nonsense probably null
R1658:Intu UTSW 3 40,647,211 (GRCm39) missense probably benign 0.20
R1701:Intu UTSW 3 40,618,694 (GRCm39) missense probably damaging 1.00
R1707:Intu UTSW 3 40,637,931 (GRCm39) missense possibly damaging 0.69
R1707:Intu UTSW 3 40,595,073 (GRCm39) missense probably benign 0.03
R1867:Intu UTSW 3 40,618,765 (GRCm39) missense probably damaging 1.00
R1868:Intu UTSW 3 40,618,765 (GRCm39) missense probably damaging 1.00
R2090:Intu UTSW 3 40,637,966 (GRCm39) missense probably benign 0.00
R2310:Intu UTSW 3 40,608,243 (GRCm39) missense probably benign
R2989:Intu UTSW 3 40,647,140 (GRCm39) missense probably benign 0.11
R4168:Intu UTSW 3 40,627,053 (GRCm39) missense probably benign 0.00
R4530:Intu UTSW 3 40,637,794 (GRCm39) missense possibly damaging 0.95
R5093:Intu UTSW 3 40,647,347 (GRCm39) missense probably benign 0.00
R5541:Intu UTSW 3 40,647,017 (GRCm39) splice site probably null
R5587:Intu UTSW 3 40,629,738 (GRCm39) missense probably damaging 0.99
R5745:Intu UTSW 3 40,647,402 (GRCm39) splice site probably null
R5809:Intu UTSW 3 40,634,020 (GRCm39) missense probably damaging 0.99
R5939:Intu UTSW 3 40,647,014 (GRCm39) missense probably damaging 1.00
R5953:Intu UTSW 3 40,633,980 (GRCm39) missense probably damaging 1.00
R6000:Intu UTSW 3 40,608,578 (GRCm39) nonsense probably null
R6245:Intu UTSW 3 40,629,756 (GRCm39) missense probably damaging 0.98
R6310:Intu UTSW 3 40,655,721 (GRCm39) nonsense probably null
R6353:Intu UTSW 3 40,608,138 (GRCm39) missense probably damaging 1.00
R6451:Intu UTSW 3 40,655,723 (GRCm39) missense possibly damaging 0.94
R6660:Intu UTSW 3 40,586,100 (GRCm39) missense probably benign 0.00
R6848:Intu UTSW 3 40,648,685 (GRCm39) missense probably benign 0.00
R7440:Intu UTSW 3 40,651,981 (GRCm39) missense probably benign 0.04
R7625:Intu UTSW 3 40,652,029 (GRCm39) missense probably benign
R7633:Intu UTSW 3 40,608,683 (GRCm39) missense probably damaging 1.00
R7798:Intu UTSW 3 40,646,359 (GRCm39) missense probably damaging 1.00
R7877:Intu UTSW 3 40,654,222 (GRCm39) missense probably benign 0.07
R7978:Intu UTSW 3 40,652,069 (GRCm39) missense probably damaging 1.00
R8319:Intu UTSW 3 40,608,202 (GRCm39) missense probably damaging 1.00
R8332:Intu UTSW 3 40,629,719 (GRCm39) missense probably benign 0.35
R8860:Intu UTSW 3 40,627,162 (GRCm39) missense probably benign 0.07
R8926:Intu UTSW 3 40,608,139 (GRCm39) missense possibly damaging 0.69
R8946:Intu UTSW 3 40,637,789 (GRCm39) missense possibly damaging 0.93
R9164:Intu UTSW 3 40,645,133 (GRCm39) missense probably damaging 1.00
R9191:Intu UTSW 3 40,646,941 (GRCm39) missense probably damaging 0.99
R9547:Intu UTSW 3 40,608,536 (GRCm39) missense probably benign
Z1177:Intu UTSW 3 40,651,946 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TCAGGCGCTTCACCAAGATC -3'
(R):5'- GGCTCTGCCCTTAACCATGTAC -3'

Posted On 2017-07-14