Incidental Mutation 'R6063:Met'
ID483905
Institutional Source Beutler Lab
Gene Symbol Met
Ensembl Gene ENSMUSG00000009376
Gene Namemet proto-oncogene
SynonymsPar4, HGF receptor, c-Met
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6063 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location17463800-17573980 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 17491968 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 243 (S243F)
Ref Sequence ENSEMBL: ENSMUSP00000111103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080469] [ENSMUST00000115442] [ENSMUST00000115443] [ENSMUST00000140070]
Predicted Effect probably damaging
Transcript: ENSMUST00000080469
AA Change: S243F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079324
Gene: ENSMUSG00000009376
AA Change: S243F

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115442
AA Change: S243F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111102
Gene: ENSMUSG00000009376
AA Change: S243F

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115443
AA Change: S243F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111103
Gene: ENSMUSG00000009376
AA Change: S243F

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Sema 52 495 4.5e-134 SMART
PSI 518 561 1.18e-9 SMART
IPT 561 654 9.43e-15 SMART
IPT 655 738 4.16e-25 SMART
IPT 740 835 3.38e-16 SMART
IPT 837 933 4.08e-10 SMART
TyrKc 1076 1335 7.65e-134 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140070
SMART Domains Protein: ENSMUSP00000117856
Gene: ENSMUSG00000009376

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Sema 52 169 4.8e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145473
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the receptor tyrosine kinase family of proteins and the product of the proto-oncogene MET. The encoded preproprotein is proteolytically processed to generate alpha and beta subunits that are linked via disulfide bonds to form the mature receptor. Further processing of the beta subunit results in the formation of the M10 peptide, which has been shown to reduce lung fibrosis. Binding of its ligand, hepatocyte growth factor, induces dimerization and activation of the receptor, which plays a role in cellular survival, embryogenesis, and cellular migration and invasion. Mutations in this gene are associated with papillary renal cell carcinoma, hepatocellular carcinoma, and various head and neck cancers. Amplification and overexpression of this gene are also associated with multiple human cancers. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous null mutants exhibit impaired embryonic development resulting in death. Abnormalities observed in various mutant lines include muscle agenesis due to impaired migration of myogenic precursors, defects of motor axon migration, and placental andliver defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,264,344 R1713C unknown Het
Ano6 C T 15: 95,948,417 T512I probably damaging Het
Ap3s1 T C 18: 46,754,438 V46A probably benign Het
Art2a-ps C A 7: 101,555,206 V42F probably damaging Het
Asph C T 4: 9,531,960 V386M probably benign Het
B4galnt4 T A 7: 141,064,730 D179E probably benign Het
Bbx T C 16: 50,251,367 I232V probably benign Het
C1ql2 A G 1: 120,341,592 I159V probably benign Het
Ccar1 A G 10: 62,776,717 V223A possibly damaging Het
Cd2ap A T 17: 42,825,911 L277I probably benign Het
Cfap44 G A 16: 44,429,892 E778K probably benign Het
Chd3 A T 11: 69,349,237 D1626E probably benign Het
Crocc C T 4: 141,041,721 G505S probably benign Het
Crocc T A 4: 141,046,540 Q72L probably damaging Het
Drosha T C 15: 12,834,070 probably benign Het
Eps8l1 T A 7: 4,471,297 S256T possibly damaging Het
F830045P16Rik A G 2: 129,474,390 V133A probably damaging Het
Fermt2 A T 14: 45,459,881 M671K possibly damaging Het
Fhdc1 G A 3: 84,446,029 L630F probably benign Het
Gm9125 A G 3: 94,050,101 F7L probably benign Het
Gon4l T C 3: 88,899,999 S1667P probably damaging Het
Greb1l A C 18: 10,557,340 K1780T probably damaging Het
H2-Q10 C T 17: 35,470,129 T8M probably benign Het
Hmcn2 A T 2: 31,434,713 T4215S probably benign Het
I0C0044D17Rik G A 4: 98,820,339 probably benign Het
Ifi204 A G 1: 173,751,657 F541L probably benign Het
Igkv6-17 C T 6: 70,371,780 A45V probably damaging Het
Intu G A 3: 40,654,094 A161T probably damaging Het
Kcnmb2 A G 3: 32,178,992 Y73C probably damaging Het
Lrit1 T C 14: 37,054,988 F22L probably benign Het
Lrp1b A T 2: 41,284,144 C699* probably null Het
Lrrc8d A G 5: 105,812,126 D134G probably benign Het
Map1b T C 13: 99,431,137 D1692G unknown Het
Mlph C A 1: 90,928,160 H96Q probably damaging Het
Mycbp2 A T 14: 103,135,146 V4088D probably damaging Het
Nampt T A 12: 32,848,659 S425T probably damaging Het
Nts G A 10: 102,484,995 H78Y probably benign Het
Nxf1 A G 19: 8,767,787 E467G possibly damaging Het
Olfml2a C A 2: 38,951,143 D230E probably benign Het
Olfr142 C A 2: 90,252,427 C187F probably benign Het
Olfr668 C T 7: 104,925,392 R124H probably benign Het
Pcsk5 A G 19: 17,454,681 probably null Het
Pde5a C A 3: 122,824,925 T629K probably benign Het
Plcb3 G T 19: 6,962,834 R462S possibly damaging Het
Pnpla6 T A 8: 3,524,156 M469K probably benign Het
Pram1 A T 17: 33,641,412 K318* probably null Het
Prkd1 T C 12: 50,342,043 R906G probably benign Het
Ptprh T A 7: 4,573,362 T300S possibly damaging Het
Rdh16f2 A G 10: 127,876,874 Y247C probably benign Het
Rimbp3 A G 16: 17,210,917 E735G probably damaging Het
Sall3 G A 18: 80,974,255 P153S possibly damaging Het
Samd4b T A 7: 28,423,631 M1L possibly damaging Het
Sept12 T C 16: 4,992,263 E136G probably damaging Het
Shpk A T 11: 73,213,444 K140* probably null Het
Sidt1 G T 16: 44,259,466 F608L probably benign Het
Skint5 A G 4: 113,490,645 Y1300H probably benign Het
Slc22a28 G A 19: 8,117,022 P212S probably benign Het
Slc22a5 A T 11: 53,867,533 F480L possibly damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc3a1 C T 17: 85,028,523 P31L probably benign Het
Slc4a7 T C 14: 14,793,964 V1074A possibly damaging Het
Snx2 C T 18: 53,209,625 Q254* probably null Het
Sox30 G A 11: 45,991,942 V600I probably benign Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Tdrd7 A G 4: 46,005,486 T431A probably benign Het
Tenm2 A T 11: 36,163,717 probably null Het
Tigar A G 6: 127,091,201 S85P probably benign Het
Tnr A C 1: 159,912,684 M1143L probably benign Het
Trio G T 15: 27,891,379 Q429K possibly damaging Het
Urb1 T C 16: 90,789,097 I452M probably benign Het
Uroc1 A T 6: 90,347,928 E461V probably benign Het
Vax1 C A 19: 59,168,604 R99L unknown Het
Xab2 A T 8: 3,613,051 I510N possibly damaging Het
Zbtb34 A T 2: 33,411,830 I233K possibly damaging Het
Zfp27 A G 7: 29,894,302 F746S probably damaging Het
Zfp651 A G 9: 121,763,532 E306G probably benign Het
Zfp719 C T 7: 43,589,626 Q213* probably null Het
Zswim6 T C 13: 107,728,577 noncoding transcript Het
Other mutations in Met
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00533:Met APN 6 17534937 unclassified probably benign
IGL01066:Met APN 6 17535105 critical splice donor site probably null
IGL01344:Met APN 6 17547032 missense probably benign 0.44
IGL01413:Met APN 6 17558896 splice site probably benign
IGL01608:Met APN 6 17558730 missense probably damaging 1.00
IGL01613:Met APN 6 17540577 missense probably damaging 1.00
IGL01820:Met APN 6 17534231 missense possibly damaging 0.89
IGL01843:Met APN 6 17491701 missense probably damaging 1.00
IGL02014:Met APN 6 17527257 splice site probably benign
IGL02027:Met APN 6 17563727 splice site probably benign
IGL02243:Met APN 6 17549094 missense probably damaging 1.00
IGL02373:Met APN 6 17491529 missense probably damaging 1.00
IGL02616:Met APN 6 17553347 missense probably damaging 1.00
IGL02702:Met APN 6 17534143 missense possibly damaging 0.92
IGL02704:Met APN 6 17491257 missense possibly damaging 0.62
IGL02714:Met APN 6 17491852 nonsense probably null
IGL02936:Met APN 6 17553397 missense probably damaging 1.00
IGL02943:Met APN 6 17535929 missense possibly damaging 0.84
IGL03057:Met APN 6 17558766 missense probably damaging 1.00
IGL03124:Met APN 6 17492078 missense probably benign 0.27
IGL03171:Met APN 6 17562273 splice site probably benign
IGL03266:Met APN 6 17540538 missense possibly damaging 0.61
IGL03285:Met APN 6 17553337 missense probably damaging 0.98
R0453:Met UTSW 6 17534198 missense possibly damaging 0.88
R0543:Met UTSW 6 17491970 missense probably damaging 1.00
R0601:Met UTSW 6 17555632 splice site probably null
R0652:Met UTSW 6 17491710 missense probably benign 0.00
R0941:Met UTSW 6 17491394 missense probably damaging 1.00
R1142:Met UTSW 6 17527183 nonsense probably null
R1553:Met UTSW 6 17491461 missense probably benign 0.01
R1569:Met UTSW 6 17531504 nonsense probably null
R1744:Met UTSW 6 17540646 missense possibly damaging 0.47
R2224:Met UTSW 6 17563722 splice site probably null
R2308:Met UTSW 6 17491742 missense probably benign 0.00
R2369:Met UTSW 6 17531528 missense probably benign 0.04
R2393:Met UTSW 6 17534198 missense probably damaging 0.99
R2419:Met UTSW 6 17535830 splice site probably benign
R2483:Met UTSW 6 17549086 missense probably damaging 1.00
R2511:Met UTSW 6 17491967 missense probably damaging 1.00
R3622:Met UTSW 6 17549086 missense probably damaging 1.00
R3623:Met UTSW 6 17549086 missense probably damaging 1.00
R3624:Met UTSW 6 17549086 missense probably damaging 1.00
R4050:Met UTSW 6 17533984 missense probably benign
R4051:Met UTSW 6 17548729 missense possibly damaging 0.86
R4159:Met UTSW 6 17562272 splice site probably null
R4208:Met UTSW 6 17548729 missense possibly damaging 0.86
R4622:Met UTSW 6 17513384 missense probably benign 0.19
R4672:Met UTSW 6 17571804 missense probably benign 0.33
R4737:Met UTSW 6 17491541 missense probably damaging 1.00
R4738:Met UTSW 6 17491541 missense probably damaging 1.00
R4834:Met UTSW 6 17491413 missense probably damaging 0.97
R4846:Met UTSW 6 17491929 missense probably damaging 0.99
R4855:Met UTSW 6 17558797 missense probably damaging 1.00
R4878:Met UTSW 6 17549059 missense probably damaging 1.00
R4902:Met UTSW 6 17546996 missense probably damaging 1.00
R5208:Met UTSW 6 17526423 nonsense probably null
R5355:Met UTSW 6 17491362 missense probably damaging 1.00
R5415:Met UTSW 6 17527085 missense probably benign 0.01
R5556:Met UTSW 6 17534176 missense probably benign 0.04
R5590:Met UTSW 6 17548782 missense probably benign 0.00
R5683:Met UTSW 6 17571744 missense probably damaging 1.00
R5872:Met UTSW 6 17562198 missense probably damaging 1.00
R5891:Met UTSW 6 17491539 missense probably benign 0.02
R5895:Met UTSW 6 17531582 missense probably benign 0.02
R6262:Met UTSW 6 17553404 missense probably benign 0.00
R6362:Met UTSW 6 17558733 missense probably damaging 1.00
R6747:Met UTSW 6 17571467 missense probably damaging 1.00
R6966:Met UTSW 6 17531532 missense possibly damaging 0.65
R6989:Met UTSW 6 17535928 missense possibly damaging 0.67
R6989:Met UTSW 6 17535929 missense probably damaging 1.00
R7017:Met UTSW 6 17491287 nonsense probably null
R7037:Met UTSW 6 17547128 intron probably benign
R7141:Met UTSW 6 17527155 missense probably benign 0.01
R7242:Met UTSW 6 17491317 missense probably damaging 1.00
R7282:Met UTSW 6 17547012 nonsense probably null
R7624:Met UTSW 6 17558835 missense probably damaging 1.00
R7770:Met UTSW 6 17491407 missense possibly damaging 0.79
R7797:Met UTSW 6 17533953 missense probably damaging 1.00
R8082:Met UTSW 6 17492313 missense probably damaging 0.98
R8109:Met UTSW 6 17562237 missense probably damaging 1.00
R8162:Met UTSW 6 17547062 missense probably damaging 0.98
R8315:Met UTSW 6 17533957 missense probably damaging 0.99
R8325:Met UTSW 6 17571672 missense probably damaging 1.00
R8348:Met UTSW 6 17571800 missense probably benign 0.00
R8354:Met UTSW 6 17491769 missense probably damaging 1.00
R8448:Met UTSW 6 17571800 missense probably benign 0.00
R8454:Met UTSW 6 17491769 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGAAAAGGACCGGTTCATC -3'
(R):5'- ACGCGGCTTGGAGGATATTAAAC -3'

Posted On2017-07-14