Incidental Mutation 'R6063:Tenm2'
ID 483923
Institutional Source Beutler Lab
Gene Symbol Tenm2
Ensembl Gene ENSMUSG00000049336
Gene Name teneurin transmembrane protein 2
Synonyms 2610040L17Rik, 9330187F13Rik, D3Bwg1534e, Ten-m2, Odz2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.480) question?
Stock # R6063 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 36006656-37235964 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 36163717 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057207] [ENSMUST00000102801] [ENSMUST00000163524]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000057207
SMART Domains Protein: ENSMUSP00000052014
Gene: ENSMUSG00000049336

DomainStartEndE-ValueType
Pfam:Ten_N 10 374 4.9e-177 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 738 766 9.63e0 SMART
EGF 769 797 1.25e1 SMART
EGF 800 832 1.4e0 SMART
low complexity region 1459 1475 N/A INTRINSIC
low complexity region 2219 2230 N/A INTRINSIC
Pfam:Tox-GHH 2681 2758 1.4e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102801
SMART Domains Protein: ENSMUSP00000099865
Gene: ENSMUSG00000049336

DomainStartEndE-ValueType
Pfam:Ten_N 9 374 2e-186 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 737 765 9.63e0 SMART
EGF 768 796 1.25e1 SMART
EGF 799 831 1.4e0 SMART
low complexity region 1458 1474 N/A INTRINSIC
low complexity region 2218 2229 N/A INTRINSIC
Pfam:Tox-GHH 2679 2757 2e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146113
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155147
Predicted Effect probably null
Transcript: ENSMUST00000163524
SMART Domains Protein: ENSMUSP00000129951
Gene: ENSMUSG00000049336

DomainStartEndE-ValueType
Pfam:Ten_N 9 374 2e-186 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 737 765 9.63e0 SMART
EGF 768 796 1.25e1 SMART
EGF 799 831 1.4e0 SMART
low complexity region 1458 1474 N/A INTRINSIC
low complexity region 2218 2229 N/A INTRINSIC
Pfam:Tox-GHH 2679 2757 2e-34 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele show abnormalities in the laterality and mapping of ipsilateral retinal projections that lead to loss of ipsilateral drive, defects in binocular vision, and impaired performance on a visual discrimination task. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,264,344 R1713C unknown Het
Ano6 C T 15: 95,948,417 T512I probably damaging Het
Ap3s1 T C 18: 46,754,438 V46A probably benign Het
Art2a-ps C A 7: 101,555,206 V42F probably damaging Het
Asph C T 4: 9,531,960 V386M probably benign Het
B4galnt4 T A 7: 141,064,730 D179E probably benign Het
Bbx T C 16: 50,251,367 I232V probably benign Het
C1ql2 A G 1: 120,341,592 I159V probably benign Het
Ccar1 A G 10: 62,776,717 V223A possibly damaging Het
Cd2ap A T 17: 42,825,911 L277I probably benign Het
Cfap44 G A 16: 44,429,892 E778K probably benign Het
Chd3 A T 11: 69,349,237 D1626E probably benign Het
Crocc C T 4: 141,041,721 G505S probably benign Het
Crocc T A 4: 141,046,540 Q72L probably damaging Het
Drosha T C 15: 12,834,070 probably benign Het
Eps8l1 T A 7: 4,471,297 S256T possibly damaging Het
F830045P16Rik A G 2: 129,474,390 V133A probably damaging Het
Fermt2 A T 14: 45,459,881 M671K possibly damaging Het
Fhdc1 G A 3: 84,446,029 L630F probably benign Het
Gm9125 A G 3: 94,050,101 F7L probably benign Het
Gon4l T C 3: 88,899,999 S1667P probably damaging Het
Greb1l A C 18: 10,557,340 K1780T probably damaging Het
H2-Q10 C T 17: 35,470,129 T8M probably benign Het
Hmcn2 A T 2: 31,434,713 T4215S probably benign Het
I0C0044D17Rik G A 4: 98,820,339 probably benign Het
Ifi204 A G 1: 173,751,657 F541L probably benign Het
Igkv6-17 C T 6: 70,371,780 A45V probably damaging Het
Intu G A 3: 40,654,094 A161T probably damaging Het
Kcnmb2 A G 3: 32,178,992 Y73C probably damaging Het
Lrit1 T C 14: 37,054,988 F22L probably benign Het
Lrp1b A T 2: 41,284,144 C699* probably null Het
Lrrc8d A G 5: 105,812,126 D134G probably benign Het
Map1b T C 13: 99,431,137 D1692G unknown Het
Met C T 6: 17,491,968 S243F probably damaging Het
Mlph C A 1: 90,928,160 H96Q probably damaging Het
Mycbp2 A T 14: 103,135,146 V4088D probably damaging Het
Nampt T A 12: 32,848,659 S425T probably damaging Het
Nts G A 10: 102,484,995 H78Y probably benign Het
Nxf1 A G 19: 8,767,787 E467G possibly damaging Het
Olfml2a C A 2: 38,951,143 D230E probably benign Het
Olfr142 C A 2: 90,252,427 C187F probably benign Het
Olfr668 C T 7: 104,925,392 R124H probably benign Het
Pcsk5 A G 19: 17,454,681 probably null Het
Pde5a C A 3: 122,824,925 T629K probably benign Het
Plcb3 G T 19: 6,962,834 R462S possibly damaging Het
Pnpla6 T A 8: 3,524,156 M469K probably benign Het
Pram1 A T 17: 33,641,412 K318* probably null Het
Prkd1 T C 12: 50,342,043 R906G probably benign Het
Ptprh T A 7: 4,573,362 T300S possibly damaging Het
Rdh16f2 A G 10: 127,876,874 Y247C probably benign Het
Rimbp3 A G 16: 17,210,917 E735G probably damaging Het
Sall3 G A 18: 80,974,255 P153S possibly damaging Het
Samd4b T A 7: 28,423,631 M1L possibly damaging Het
Sept12 T C 16: 4,992,263 E136G probably damaging Het
Shpk A T 11: 73,213,444 K140* probably null Het
Sidt1 G T 16: 44,259,466 F608L probably benign Het
Skint5 A G 4: 113,490,645 Y1300H probably benign Het
Slc22a28 G A 19: 8,117,022 P212S probably benign Het
Slc22a5 A T 11: 53,867,533 F480L possibly damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc3a1 C T 17: 85,028,523 P31L probably benign Het
Slc4a7 T C 14: 14,793,964 V1074A possibly damaging Het
Snx2 C T 18: 53,209,625 Q254* probably null Het
Sox30 G A 11: 45,991,942 V600I probably benign Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Tdrd7 A G 4: 46,005,486 T431A probably benign Het
Tigar A G 6: 127,091,201 S85P probably benign Het
Tnr A C 1: 159,912,684 M1143L probably benign Het
Trio G T 15: 27,891,379 Q429K possibly damaging Het
Urb1 T C 16: 90,789,097 I452M probably benign Het
Uroc1 A T 6: 90,347,928 E461V probably benign Het
Vax1 C A 19: 59,168,604 R99L unknown Het
Xab2 A T 8: 3,613,051 I510N possibly damaging Het
Zbtb34 A T 2: 33,411,830 I233K possibly damaging Het
Zfp27 A G 7: 29,894,302 F746S probably damaging Het
Zfp651 A G 9: 121,763,532 E306G probably benign Het
Zfp719 C T 7: 43,589,626 Q213* probably null Het
Zswim6 T C 13: 107,728,577 noncoding transcript Het
Other mutations in Tenm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Tenm2 APN 11 36206899 splice site probably benign
IGL00834:Tenm2 APN 11 36024258 missense probably damaging 1.00
IGL00911:Tenm2 APN 11 36008733 nonsense probably null
IGL00937:Tenm2 APN 11 36024623 missense probably damaging 1.00
IGL01154:Tenm2 APN 11 36041544 missense probably damaging 1.00
IGL01313:Tenm2 APN 11 36024248 missense probably damaging 0.98
IGL01346:Tenm2 APN 11 36027405 nonsense probably null
IGL01539:Tenm2 APN 11 36106827 missense possibly damaging 0.89
IGL01629:Tenm2 APN 11 36864884 missense probably damaging 0.98
IGL01780:Tenm2 APN 11 36046941 missense probably benign
IGL01821:Tenm2 APN 11 36023883 missense probably damaging 0.98
IGL01988:Tenm2 APN 11 36027251 missense probably damaging 1.00
IGL02002:Tenm2 APN 11 36207095 missense probably benign
IGL02449:Tenm2 APN 11 36023622 missense probably damaging 0.99
IGL02505:Tenm2 APN 11 36051916 nonsense probably null
IGL02649:Tenm2 APN 11 36207085 missense possibly damaging 0.85
IGL02688:Tenm2 APN 11 36068458 missense probably benign 0.05
IGL02801:Tenm2 APN 11 36047030 nonsense probably null
IGL02928:Tenm2 APN 11 36027170 missense possibly damaging 0.69
IGL02940:Tenm2 APN 11 36041644 missense probably damaging 1.00
IGL03202:Tenm2 APN 11 36024548 missense probably damaging 1.00
IGL03213:Tenm2 APN 11 36023330 missense probably benign 0.05
IGL03276:Tenm2 APN 11 36072776 missense possibly damaging 0.95
IGL03296:Tenm2 APN 11 36052025 splice site probably null
IGL03381:Tenm2 APN 11 36068411 missense probably benign 0.01
IGL03398:Tenm2 APN 11 36024543 missense probably damaging 1.00
browser UTSW 11 36046765 critical splice donor site probably null
mosaic UTSW 11 36063775 critical splice donor site probably null
IGL02799:Tenm2 UTSW 11 36273408 missense probably damaging 1.00
PIT4260001:Tenm2 UTSW 11 36163730 missense probably damaging 1.00
PIT4382001:Tenm2 UTSW 11 36063902 missense probably damaging 0.99
R0004:Tenm2 UTSW 11 36023357 missense probably damaging 1.00
R0420:Tenm2 UTSW 11 36207124 splice site probably benign
R0537:Tenm2 UTSW 11 36163730 missense probably damaging 1.00
R0599:Tenm2 UTSW 11 36024780 missense possibly damaging 0.93
R0636:Tenm2 UTSW 11 36943976 missense probably damaging 1.00
R0693:Tenm2 UTSW 11 36024809 missense probably damaging 1.00
R0991:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R0992:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1167:Tenm2 UTSW 11 36864684 missense probably benign 0.30
R1177:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1178:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1179:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1180:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1181:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1193:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1194:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1259:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1265:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1267:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1268:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1269:Tenm2 UTSW 11 36008358 missense possibly damaging 0.64
R1270:Tenm2 UTSW 11 36041659 missense probably damaging 1.00
R1272:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1273:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1311:Tenm2 UTSW 11 36068594 splice site probably benign
R1374:Tenm2 UTSW 11 36008454 missense probably benign 0.00
R1542:Tenm2 UTSW 11 36300220 missense probably damaging 0.99
R1573:Tenm2 UTSW 11 36047069 missense probably damaging 1.00
R1579:Tenm2 UTSW 11 36106783 missense probably damaging 1.00
R1697:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1722:Tenm2 UTSW 11 36008103 missense probably damaging 1.00
R1756:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1793:Tenm2 UTSW 11 36023382 missense probably damaging 0.99
R1950:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1954:Tenm2 UTSW 11 36047547 missense possibly damaging 0.87
R2025:Tenm2 UTSW 11 36047264 nonsense probably null
R2117:Tenm2 UTSW 11 36024854 missense probably damaging 1.00
R2244:Tenm2 UTSW 11 36864862 missense probably damaging 0.98
R2298:Tenm2 UTSW 11 36046777 missense possibly damaging 0.62
R2432:Tenm2 UTSW 11 36027191 missense probably damaging 1.00
R3014:Tenm2 UTSW 11 36023973 missense probably damaging 1.00
R3115:Tenm2 UTSW 11 36023366 missense probably damaging 1.00
R3684:Tenm2 UTSW 11 36051817 missense probably benign 0.00
R3685:Tenm2 UTSW 11 36051817 missense probably benign 0.00
R3705:Tenm2 UTSW 11 36068326 missense probably damaging 0.97
R3820:Tenm2 UTSW 11 36024320 missense probably damaging 0.98
R3821:Tenm2 UTSW 11 36024320 missense probably damaging 0.98
R3822:Tenm2 UTSW 11 36024320 missense probably damaging 0.98
R3844:Tenm2 UTSW 11 36047538 missense probably damaging 0.98
R3878:Tenm2 UTSW 11 36139574 critical splice donor site probably null
R4019:Tenm2 UTSW 11 36047074 missense probably benign 0.04
R4062:Tenm2 UTSW 11 36008655 missense probably damaging 1.00
R4367:Tenm2 UTSW 11 36027398 missense probably benign
R4395:Tenm2 UTSW 11 36024624 missense probably benign 0.23
R4508:Tenm2 UTSW 11 36008345 missense possibly damaging 0.82
R4534:Tenm2 UTSW 11 36063104 missense possibly damaging 0.64
R4539:Tenm2 UTSW 11 36046780 missense probably damaging 1.00
R4644:Tenm2 UTSW 11 36047136 missense probably benign 0.00
R4661:Tenm2 UTSW 11 36024448 missense probably damaging 0.99
R4669:Tenm2 UTSW 11 36010487 missense probably damaging 1.00
R4687:Tenm2 UTSW 11 36049097 missense probably benign
R4711:Tenm2 UTSW 11 36300212 missense probably damaging 0.98
R4816:Tenm2 UTSW 11 36027290 missense probably damaging 1.00
R4843:Tenm2 UTSW 11 36024020 missense probably damaging 1.00
R4850:Tenm2 UTSW 11 36023488 nonsense probably null
R4870:Tenm2 UTSW 11 36078569 missense probably damaging 1.00
R5058:Tenm2 UTSW 11 36207080 missense possibly damaging 0.80
R5071:Tenm2 UTSW 11 36068381 missense probably damaging 0.99
R5073:Tenm2 UTSW 11 36068381 missense probably damaging 0.99
R5074:Tenm2 UTSW 11 36068381 missense probably damaging 0.99
R5081:Tenm2 UTSW 11 36024633 missense possibly damaging 0.95
R5093:Tenm2 UTSW 11 36944162 missense probably damaging 1.00
R5170:Tenm2 UTSW 11 36024806 missense probably damaging 0.98
R5253:Tenm2 UTSW 11 36047201 nonsense probably null
R5343:Tenm2 UTSW 11 36069503 missense probably benign 0.00
R5493:Tenm2 UTSW 11 36864676 missense probably benign 0.01
R5600:Tenm2 UTSW 11 36163714 splice site probably null
R5677:Tenm2 UTSW 11 36141683 missense probably damaging 0.98
R5703:Tenm2 UTSW 11 36023799 missense probably benign 0.34
R5707:Tenm2 UTSW 11 36047182 missense possibly damaging 0.79
R6026:Tenm2 UTSW 11 36072729 critical splice donor site probably null
R6086:Tenm2 UTSW 11 36008646 missense possibly damaging 0.64
R6151:Tenm2 UTSW 11 36008783 missense probably damaging 1.00
R6169:Tenm2 UTSW 11 36139690 missense probably damaging 0.99
R6193:Tenm2 UTSW 11 36046794 missense probably damaging 1.00
R6405:Tenm2 UTSW 11 36864859 missense probably benign 0.44
R6477:Tenm2 UTSW 11 36010507 critical splice acceptor site probably null
R6607:Tenm2 UTSW 11 36063775 critical splice donor site probably null
R6668:Tenm2 UTSW 11 36046765 critical splice donor site probably null
R6825:Tenm2 UTSW 11 36046884 missense probably benign 0.02
R6885:Tenm2 UTSW 11 36023580 missense possibly damaging 0.95
R7017:Tenm2 UTSW 11 36171409 missense probably damaging 0.98
R7115:Tenm2 UTSW 11 36163817 missense probably damaging 0.99
R7153:Tenm2 UTSW 11 36024182 missense probably damaging 0.98
R7173:Tenm2 UTSW 11 36041551 missense probably damaging 0.99
R7199:Tenm2 UTSW 11 36171436 missense probably damaging 1.00
R7205:Tenm2 UTSW 11 36049129 missense probably damaging 0.99
R7250:Tenm2 UTSW 11 36072798 missense probably damaging 1.00
R7290:Tenm2 UTSW 11 36023471 missense probably damaging 1.00
R7366:Tenm2 UTSW 11 36069414 missense probably benign 0.09
R7432:Tenm2 UTSW 11 36864941 missense probably benign
R7504:Tenm2 UTSW 11 36139743 missense probably damaging 1.00
R7513:Tenm2 UTSW 11 36051900 missense probably benign 0.34
R7523:Tenm2 UTSW 11 36078581 splice site probably null
R7527:Tenm2 UTSW 11 36206976 missense probably damaging 1.00
R7648:Tenm2 UTSW 11 36106736 missense probably damaging 1.00
R7653:Tenm2 UTSW 11 36047347 missense probably benign 0.09
R7717:Tenm2 UTSW 11 36864935 missense probably damaging 0.97
R7739:Tenm2 UTSW 11 36069561 missense possibly damaging 0.50
R7762:Tenm2 UTSW 11 36023306 missense possibly damaging 0.74
R7786:Tenm2 UTSW 11 36010449 missense probably damaging 0.99
R7803:Tenm2 UTSW 11 36047116 missense probably damaging 0.98
R7834:Tenm2 UTSW 11 36024854 missense probably damaging 1.00
R7838:Tenm2 UTSW 11 36106799 missense probably benign 0.02
R8073:Tenm2 UTSW 11 36139644 missense possibly damaging 0.56
R8076:Tenm2 UTSW 11 36027221 missense probably benign 0.23
R8109:Tenm2 UTSW 11 36008310 missense probably benign
R8306:Tenm2 UTSW 11 36069369 missense possibly damaging 0.52
R8352:Tenm2 UTSW 11 36023601 missense probably damaging 0.98
R8452:Tenm2 UTSW 11 36023601 missense probably damaging 0.98
R8864:Tenm2 UTSW 11 36027195 missense possibly damaging 0.95
R8880:Tenm2 UTSW 11 36051961 missense probably damaging 0.99
R8943:Tenm2 UTSW 11 36944034 missense probably damaging 0.98
R8969:Tenm2 UTSW 11 36051861 missense probably damaging 0.99
R9168:Tenm2 UTSW 11 36039895 missense probably damaging 1.00
R9279:Tenm2 UTSW 11 36068476 missense probably benign 0.00
R9294:Tenm2 UTSW 11 36024500 missense probably damaging 0.98
R9320:Tenm2 UTSW 11 36023647 missense probably damaging 0.99
R9373:Tenm2 UTSW 11 36039886 missense probably damaging 1.00
R9408:Tenm2 UTSW 11 36069419
R9410:Tenm2 UTSW 11 36141569
RF021:Tenm2 UTSW 11 36024203 missense possibly damaging 0.95
X0018:Tenm2 UTSW 11 36024200 missense probably damaging 1.00
X0063:Tenm2 UTSW 11 36024730 missense probably benign
Z1088:Tenm2 UTSW 11 36273267 missense probably damaging 1.00
Z1177:Tenm2 UTSW 11 36008234 missense possibly damaging 0.95
Z1177:Tenm2 UTSW 11 36300335 missense probably damaging 0.98
Z1177:Tenm2 UTSW 11 36385130 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCTTTTACAGGAAATCCGACC -3'
(R):5'- GGTGACTGATTACTAAATGACTGC -3'

Posted On 2017-07-14