Mutagenetix > Incidental Mutation

Incidental Mutation 'R6063:Map1b'

483930

Institutional Source

Beutler Lab

Gene Symbol

Map1b

Ensembl Gene

ENSMUSG00000052727

Gene Name

microtubule-associated protein 1B

Synonyms

Mtap1b, MAP5, Mtap-5, Mtap5, LC1

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6063 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

99421446-99516540 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 99431137 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1692 (D1692G)

Ref Sequence

ENSEMBL: ENSMUSP00000068374 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064762]

AlphaFold

P14873

Predicted Effect

unknown
Transcript: ENSMUST00000064762
AA Change: D1692G

SMART Domains

Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: D1692G

Domain	Start	End	E-Value	Type
low complexity region	41	50	N/A	INTRINSIC
Blast:Lactamase_B	270	514	1e-56	BLAST
low complexity region	578	595	N/A	INTRINSIC
low complexity region	597	617	N/A	INTRINSIC
SCOP:d1gkub2	633	735	8e-4	SMART
low complexity region	771	813	N/A	INTRINSIC
low complexity region	855	866	N/A	INTRINSIC
low complexity region	889	913	N/A	INTRINSIC
low complexity region	935	956	N/A	INTRINSIC
low complexity region	1006	1030	N/A	INTRINSIC
low complexity region	1247	1261	N/A	INTRINSIC
low complexity region	1390	1404	N/A	INTRINSIC
low complexity region	1545	1557	N/A	INTRINSIC
low complexity region	1724	1735	N/A	INTRINSIC
Pfam:MAP1B_neuraxin	1891	1907	1.9e-10	PFAM
Pfam:MAP1B_neuraxin	1908	1924	8.3e-11	PFAM
Pfam:MAP1B_neuraxin	1942	1958	3.1e-9	PFAM
Pfam:MAP1B_neuraxin	1959	1975	6.2e-9	PFAM
Pfam:MAP1B_neuraxin	2027	2043	2.9e-10	PFAM
Pfam:MAP1B_neuraxin	2044	2060	3.9e-9	PFAM
low complexity region	2227	2257	N/A	INTRINSIC
low complexity region	2286	2307	N/A	INTRINSIC
low complexity region	2316	2343	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223693

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224702

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.1%
20x: 94.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	G	A	17: 24,264,344	R1713C	unknown	Het
Ano6	C	T	15: 95,948,417	T512I	probably damaging	Het
Ap3s1	T	C	18: 46,754,438	V46A	probably benign	Het
Art2a-ps	C	A	7: 101,555,206	V42F	probably damaging	Het
Asph	C	T	4: 9,531,960	V386M	probably benign	Het
B4galnt4	T	A	7: 141,064,730	D179E	probably benign	Het
Bbx	T	C	16: 50,251,367	I232V	probably benign	Het
C1ql2	A	G	1: 120,341,592	I159V	probably benign	Het
Ccar1	A	G	10: 62,776,717	V223A	possibly damaging	Het
Cd2ap	A	T	17: 42,825,911	L277I	probably benign	Het
Cfap44	G	A	16: 44,429,892	E778K	probably benign	Het
Chd3	A	T	11: 69,349,237	D1626E	probably benign	Het
Crocc	C	T	4: 141,041,721	G505S	probably benign	Het
Crocc	T	A	4: 141,046,540	Q72L	probably damaging	Het
Drosha	T	C	15: 12,834,070		probably benign	Het
Eps8l1	T	A	7: 4,471,297	S256T	possibly damaging	Het
F830045P16Rik	A	G	2: 129,474,390	V133A	probably damaging	Het
Fermt2	A	T	14: 45,459,881	M671K	possibly damaging	Het
Fhdc1	G	A	3: 84,446,029	L630F	probably benign	Het
Gm9125	A	G	3: 94,050,101	F7L	probably benign	Het
Gon4l	T	C	3: 88,899,999	S1667P	probably damaging	Het
Greb1l	A	C	18: 10,557,340	K1780T	probably damaging	Het
H2-Q10	C	T	17: 35,470,129	T8M	probably benign	Het
Hmcn2	A	T	2: 31,434,713	T4215S	probably benign	Het
I0C0044D17Rik	G	A	4: 98,820,339		probably benign	Het
Ifi204	A	G	1: 173,751,657	F541L	probably benign	Het
Igkv6-17	C	T	6: 70,371,780	A45V	probably damaging	Het
Intu	G	A	3: 40,654,094	A161T	probably damaging	Het
Kcnmb2	A	G	3: 32,178,992	Y73C	probably damaging	Het
Lrit1	T	C	14: 37,054,988	F22L	probably benign	Het
Lrp1b	A	T	2: 41,284,144	C699*	probably null	Het
Lrrc8d	A	G	5: 105,812,126	D134G	probably benign	Het
Met	C	T	6: 17,491,968	S243F	probably damaging	Het
Mlph	C	A	1: 90,928,160	H96Q	probably damaging	Het
Mycbp2	A	T	14: 103,135,146	V4088D	probably damaging	Het
Nampt	T	A	12: 32,848,659	S425T	probably damaging	Het
Nts	G	A	10: 102,484,995	H78Y	probably benign	Het
Nxf1	A	G	19: 8,767,787	E467G	possibly damaging	Het
Olfml2a	C	A	2: 38,951,143	D230E	probably benign	Het
Olfr142	C	A	2: 90,252,427	C187F	probably benign	Het
Olfr668	C	T	7: 104,925,392	R124H	probably benign	Het
Pcsk5	A	G	19: 17,454,681		probably null	Het
Pde5a	C	A	3: 122,824,925	T629K	probably benign	Het
Plcb3	G	T	19: 6,962,834	R462S	possibly damaging	Het
Pnpla6	T	A	8: 3,524,156	M469K	probably benign	Het
Pram1	A	T	17: 33,641,412	K318*	probably null	Het
Prkd1	T	C	12: 50,342,043	R906G	probably benign	Het
Ptprh	T	A	7: 4,573,362	T300S	possibly damaging	Het
Rdh16f2	A	G	10: 127,876,874	Y247C	probably benign	Het
Rimbp3	A	G	16: 17,210,917	E735G	probably damaging	Het
Sall3	G	A	18: 80,974,255	P153S	possibly damaging	Het
Samd4b	T	A	7: 28,423,631	M1L	possibly damaging	Het
Sept12	T	C	16: 4,992,263	E136G	probably damaging	Het
Shpk	A	T	11: 73,213,444	K140*	probably null	Het
Sidt1	G	T	16: 44,259,466	F608L	probably benign	Het
Skint5	A	G	4: 113,490,645	Y1300H	probably benign	Het
Slc22a28	G	A	19: 8,117,022	P212S	probably benign	Het
Slc22a5	A	T	11: 53,867,533	F480L	possibly damaging	Het
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Slc3a1	C	T	17: 85,028,523	P31L	probably benign	Het
Slc4a7	T	C	14: 14,793,964	V1074A	possibly damaging	Het
Snx2	C	T	18: 53,209,625	Q254*	probably null	Het
Sox30	G	A	11: 45,991,942	V600I	probably benign	Het
Svil	T	G	18: 5,106,724	V1855G	probably damaging	Het
Tdrd7	A	G	4: 46,005,486	T431A	probably benign	Het
Tenm2	A	T	11: 36,163,717		probably null	Het
Tigar	A	G	6: 127,091,201	S85P	probably benign	Het
Tnr	A	C	1: 159,912,684	M1143L	probably benign	Het
Trio	G	T	15: 27,891,379	Q429K	possibly damaging	Het
Urb1	T	C	16: 90,789,097	I452M	probably benign	Het
Uroc1	A	T	6: 90,347,928	E461V	probably benign	Het
Vax1	C	A	19: 59,168,604	R99L	unknown	Het
Xab2	A	T	8: 3,613,051	I510N	possibly damaging	Het
Zbtb34	A	T	2: 33,411,830	I233K	possibly damaging	Het
Zfp27	A	G	7: 29,894,302	F746S	probably damaging	Het
Zfp651	A	G	9: 121,763,532	E306G	probably benign	Het
Zfp719	C	T	7: 43,589,626	Q213*	probably null	Het
Zswim6	T	C	13: 107,728,577		noncoding transcript	Het

Other mutations in Map1b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00508:Map1b	APN	13	99429233	missense	unknown
IGL00533:Map1b	APN	13	99432604	missense	unknown
IGL00801:Map1b	APN	13	99430097	missense	unknown
IGL01141:Map1b	APN	13	99434761	missense	probably damaging	1.00
IGL01418:Map1b	APN	13	99431830	missense	unknown
IGL01464:Map1b	APN	13	99432743	missense	unknown
IGL01690:Map1b	APN	13	99435004	missense	probably damaging	1.00
IGL01991:Map1b	APN	13	99429569	missense	unknown
IGL02245:Map1b	APN	13	99431528	missense	unknown
IGL02376:Map1b	APN	13	99435595	missense	probably damaging	1.00
IGL02380:Map1b	APN	13	99431143	missense	unknown
IGL02442:Map1b	APN	13	99508198	missense	probably damaging	1.00
IGL02465:Map1b	APN	13	99433406	missense	unknown
IGL02816:Map1b	APN	13	99441755	missense	probably damaging	1.00
IGL02859:Map1b	APN	13	99433036	missense	unknown
IGL02934:Map1b	APN	13	99435131	missense	probably benign	0.09
IGL02970:Map1b	APN	13	99430734	nonsense	probably null
IGL03148:Map1b	APN	13	99441695	missense	probably damaging	1.00
IGL03401:Map1b	APN	13	99427268	missense	unknown
IGL03138:Map1b	UTSW	13	99425826	missense	unknown
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0006:Map1b	UTSW	13	99435302	missense	probably damaging	1.00
R0035:Map1b	UTSW	13	99435338	missense	probably damaging	1.00
R0069:Map1b	UTSW	13	99429848	missense	unknown
R0315:Map1b	UTSW	13	99431116	missense	unknown
R0539:Map1b	UTSW	13	99434018	missense	unknown
R0548:Map1b	UTSW	13	99431683	missense	unknown
R0613:Map1b	UTSW	13	99441641	missense	probably damaging	1.00
R0730:Map1b	UTSW	13	99429766	nonsense	probably null
R1103:Map1b	UTSW	13	99427466	splice site	probably benign
R1300:Map1b	UTSW	13	99432521	missense	unknown
R1353:Map1b	UTSW	13	99427326	missense	unknown
R1387:Map1b	UTSW	13	99432650	missense	unknown
R1481:Map1b	UTSW	13	99431171	missense	unknown
R1509:Map1b	UTSW	13	99431528	missense	unknown
R1521:Map1b	UTSW	13	99432739	missense	unknown
R1604:Map1b	UTSW	13	99429572	missense	unknown
R1649:Map1b	UTSW	13	99516478	missense	probably benign	0.03
R1651:Map1b	UTSW	13	99432583	missense	unknown
R1661:Map1b	UTSW	13	99431929	missense	unknown
R1665:Map1b	UTSW	13	99431929	missense	unknown
R1770:Map1b	UTSW	13	99430493	missense	unknown
R1926:Map1b	UTSW	13	99430692	missense	unknown
R1928:Map1b	UTSW	13	99430946	missense	unknown
R2093:Map1b	UTSW	13	99429670	missense	unknown
R2110:Map1b	UTSW	13	99431121	missense	unknown
R2116:Map1b	UTSW	13	99430644	missense	unknown
R2164:Map1b	UTSW	13	99429338	missense	unknown
R2207:Map1b	UTSW	13	99431083	missense	unknown
R2273:Map1b	UTSW	13	99432084	missense	unknown
R2443:Map1b	UTSW	13	99430411	missense	unknown
R3054:Map1b	UTSW	13	99432742	missense	unknown
R3766:Map1b	UTSW	13	99434087	missense	unknown
R3911:Map1b	UTSW	13	99431072	missense	unknown
R4005:Map1b	UTSW	13	99429907	missense	unknown
R4130:Map1b	UTSW	13	99431680	missense	unknown
R4513:Map1b	UTSW	13	99444233	missense	probably damaging	1.00
R4613:Map1b	UTSW	13	99430302	nonsense	probably null
R4633:Map1b	UTSW	13	99434942	missense	probably damaging	1.00
R4646:Map1b	UTSW	13	99432469	missense	unknown
R4690:Map1b	UTSW	13	99431068	missense	unknown
R4704:Map1b	UTSW	13	99430475	missense	unknown
R4836:Map1b	UTSW	13	99431054	missense	unknown
R4916:Map1b	UTSW	13	99433300	missense	unknown
R4951:Map1b	UTSW	13	99432427	missense	unknown
R4960:Map1b	UTSW	13	99432212	missense	probably benign	0.23
R4961:Map1b	UTSW	13	99435653	missense	probably damaging	1.00
R5030:Map1b	UTSW	13	99434174	missense	unknown
R5090:Map1b	UTSW	13	99430026	nonsense	probably null
R5469:Map1b	UTSW	13	99429338	missense	unknown
R5820:Map1b	UTSW	13	99432824	missense	unknown
R5885:Map1b	UTSW	13	99430081	missense	unknown
R5915:Map1b	UTSW	13	99430331	missense	unknown
R5923:Map1b	UTSW	13	99433153	missense	unknown
R6102:Map1b	UTSW	13	99425873	missense	unknown
R6218:Map1b	UTSW	13	99433206	missense	unknown
R6435:Map1b	UTSW	13	99516363	missense	probably damaging	0.99
R6663:Map1b	UTSW	13	99430022	missense	unknown
R6765:Map1b	UTSW	13	99425941	missense	unknown
R6860:Map1b	UTSW	13	99434767	missense	probably damaging	1.00
R6997:Map1b	UTSW	13	99430634	missense	unknown
R7001:Map1b	UTSW	13	99430593	missense	unknown
R7310:Map1b	UTSW	13	99433655	missense	unknown
R7349:Map1b	UTSW	13	99433640	missense	unknown
R7448:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7449:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7452:Map1b	UTSW	13	99508140	missense	probably damaging	0.99
R7810:Map1b	UTSW	13	99431882	missense	unknown
R7820:Map1b	UTSW	13	99431177	missense	unknown
R8396:Map1b	UTSW	13	99434113	missense	unknown
R8470:Map1b	UTSW	13	99516442	missense	probably damaging	0.98
R8535:Map1b	UTSW	13	99435154	missense	probably damaging	1.00
R8777:Map1b	UTSW	13	99430796	missense	unknown
R8777-TAIL:Map1b	UTSW	13	99430796	missense	unknown
R8812:Map1b	UTSW	13	99432815	missense	unknown
R8903:Map1b	UTSW	13	99432509	nonsense	probably null
R8928:Map1b	UTSW	13	99432116	missense	unknown
R8954:Map1b	UTSW	13	99434227	missense	unknown
R9164:Map1b	UTSW	13	99425843	missense	unknown
R9164:Map1b	UTSW	13	99432308	nonsense	probably null
R9190:Map1b	UTSW	13	99435406	missense	probably damaging	0.99
R9334:Map1b	UTSW	13	99431640	missense	unknown
R9339:Map1b	UTSW	13	99431062	missense	unknown
R9357:Map1b	UTSW	13	99430200	nonsense	probably null
R9430:Map1b	UTSW	13	99434108	missense	unknown
RF003:Map1b	UTSW	13	99430750	missense	unknown
X0019:Map1b	UTSW	13	99429968	missense	unknown
X0019:Map1b	UTSW	13	99432412	missense	unknown
Z1088:Map1b	UTSW	13	99508115	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- TCTCTGGGAGGAACAACATCAG -3'
(R):5'- AAGAGTGCCCAAGACCGATG -3'

Posted On

2017-07-14