Incidental Mutation 'R6063:Fermt2'
ID483934
Institutional Source Beutler Lab
Gene Symbol Fermt2
Ensembl Gene ENSMUSG00000037712
Gene Namefermitin family member 2
SynonymsPlekhc1, Mig2, Kindlin-2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6063 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location45458795-45530118 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 45459881 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 671 (M671K)
Ref Sequence ENSEMBL: ENSMUSP00000044554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045905]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045905
AA Change: M671K

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000044554
Gene: ENSMUSG00000037712
AA Change: M671K

DomainStartEndE-ValueType
Blast:B41 16 45 2e-9 BLAST
low complexity region 46 57 N/A INTRINSIC
B41 93 573 5.09e-56 SMART
PH 373 478 2.7e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158144
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mice are embryonic lethal at or before E7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,264,344 R1713C unknown Het
Ano6 C T 15: 95,948,417 T512I probably damaging Het
Ap3s1 T C 18: 46,754,438 V46A probably benign Het
Art2a-ps C A 7: 101,555,206 V42F probably damaging Het
Asph C T 4: 9,531,960 V386M probably benign Het
B4galnt4 T A 7: 141,064,730 D179E probably benign Het
Bbx T C 16: 50,251,367 I232V probably benign Het
C1ql2 A G 1: 120,341,592 I159V probably benign Het
Ccar1 A G 10: 62,776,717 V223A possibly damaging Het
Cd2ap A T 17: 42,825,911 L277I probably benign Het
Cfap44 G A 16: 44,429,892 E778K probably benign Het
Chd3 A T 11: 69,349,237 D1626E probably benign Het
Crocc C T 4: 141,041,721 G505S probably benign Het
Crocc T A 4: 141,046,540 Q72L probably damaging Het
Drosha T C 15: 12,834,070 probably benign Het
Eps8l1 T A 7: 4,471,297 S256T possibly damaging Het
F830045P16Rik A G 2: 129,474,390 V133A probably damaging Het
Fhdc1 G A 3: 84,446,029 L630F probably benign Het
Gm9125 A G 3: 94,050,101 F7L probably benign Het
Gon4l T C 3: 88,899,999 S1667P probably damaging Het
Greb1l A C 18: 10,557,340 K1780T probably damaging Het
H2-Q10 C T 17: 35,470,129 T8M probably benign Het
Hmcn2 A T 2: 31,434,713 T4215S probably benign Het
I0C0044D17Rik G A 4: 98,820,339 probably benign Het
Ifi204 A G 1: 173,751,657 F541L probably benign Het
Igkv6-17 C T 6: 70,371,780 A45V probably damaging Het
Intu G A 3: 40,654,094 A161T probably damaging Het
Kcnmb2 A G 3: 32,178,992 Y73C probably damaging Het
Lrit1 T C 14: 37,054,988 F22L probably benign Het
Lrp1b A T 2: 41,284,144 C699* probably null Het
Lrrc8d A G 5: 105,812,126 D134G probably benign Het
Map1b T C 13: 99,431,137 D1692G unknown Het
Met C T 6: 17,491,968 S243F probably damaging Het
Mlph C A 1: 90,928,160 H96Q probably damaging Het
Mycbp2 A T 14: 103,135,146 V4088D probably damaging Het
Nampt T A 12: 32,848,659 S425T probably damaging Het
Nts G A 10: 102,484,995 H78Y probably benign Het
Nxf1 A G 19: 8,767,787 E467G possibly damaging Het
Olfml2a C A 2: 38,951,143 D230E probably benign Het
Olfr142 C A 2: 90,252,427 C187F probably benign Het
Olfr668 C T 7: 104,925,392 R124H probably benign Het
Pcsk5 A G 19: 17,454,681 probably null Het
Pde5a C A 3: 122,824,925 T629K probably benign Het
Plcb3 G T 19: 6,962,834 R462S possibly damaging Het
Pnpla6 T A 8: 3,524,156 M469K probably benign Het
Pram1 A T 17: 33,641,412 K318* probably null Het
Prkd1 T C 12: 50,342,043 R906G probably benign Het
Ptprh T A 7: 4,573,362 T300S possibly damaging Het
Rdh16f2 A G 10: 127,876,874 Y247C probably benign Het
Rimbp3 A G 16: 17,210,917 E735G probably damaging Het
Sall3 G A 18: 80,974,255 P153S possibly damaging Het
Samd4b T A 7: 28,423,631 M1L possibly damaging Het
Sept12 T C 16: 4,992,263 E136G probably damaging Het
Shpk A T 11: 73,213,444 K140* probably null Het
Sidt1 G T 16: 44,259,466 F608L probably benign Het
Skint5 A G 4: 113,490,645 Y1300H probably benign Het
Slc22a28 G A 19: 8,117,022 P212S probably benign Het
Slc22a5 A T 11: 53,867,533 F480L possibly damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc3a1 C T 17: 85,028,523 P31L probably benign Het
Slc4a7 T C 14: 14,793,964 V1074A possibly damaging Het
Snx2 C T 18: 53,209,625 Q254* probably null Het
Sox30 G A 11: 45,991,942 V600I probably benign Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Tdrd7 A G 4: 46,005,486 T431A probably benign Het
Tenm2 A T 11: 36,163,717 probably null Het
Tigar A G 6: 127,091,201 S85P probably benign Het
Tnr A C 1: 159,912,684 M1143L probably benign Het
Trio G T 15: 27,891,379 Q429K possibly damaging Het
Urb1 T C 16: 90,789,097 I452M probably benign Het
Uroc1 A T 6: 90,347,928 E461V probably benign Het
Vax1 C A 19: 59,168,604 R99L unknown Het
Xab2 A T 8: 3,613,051 I510N possibly damaging Het
Zbtb34 A T 2: 33,411,830 I233K possibly damaging Het
Zfp27 A G 7: 29,894,302 F746S probably damaging Het
Zfp651 A G 9: 121,763,532 E306G probably benign Het
Zfp719 C T 7: 43,589,626 Q213* probably null Het
Zswim6 T C 13: 107,728,577 noncoding transcript Het
Other mutations in Fermt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Fermt2 APN 14 45464863 missense probably damaging 1.00
IGL01859:Fermt2 APN 14 45459956 missense possibly damaging 0.94
IGL02719:Fermt2 APN 14 45504656 missense probably damaging 1.00
IGL03182:Fermt2 APN 14 45461768 missense possibly damaging 0.77
ANU18:Fermt2 UTSW 14 45464863 missense probably damaging 1.00
R0107:Fermt2 UTSW 14 45464822 missense probably damaging 0.98
R0671:Fermt2 UTSW 14 45469319 missense probably benign 0.09
R1172:Fermt2 UTSW 14 45459968 missense possibly damaging 0.91
R1227:Fermt2 UTSW 14 45459990 missense probably benign 0.19
R1480:Fermt2 UTSW 14 45461787 missense possibly damaging 0.88
R2219:Fermt2 UTSW 14 45475897 missense probably benign
R2937:Fermt2 UTSW 14 45504491 splice site probably null
R4765:Fermt2 UTSW 14 45462236 missense probably benign 0.01
R5921:Fermt2 UTSW 14 45464746 missense probably damaging 1.00
R6216:Fermt2 UTSW 14 45459881 missense possibly damaging 0.77
R6254:Fermt2 UTSW 14 45476059 missense probably damaging 1.00
R6964:Fermt2 UTSW 14 45465142 missense probably damaging 0.99
R7574:Fermt2 UTSW 14 45469325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGCAGATTAACAATCGTGC -3'
(R):5'- ACTTAAAGTCCGGAAGCTTCC -3'

Posted On2017-07-14