Incidental Mutation 'R6063:Pcsk5'
ID483958
Institutional Source Beutler Lab
Gene Symbol Pcsk5
Ensembl Gene ENSMUSG00000024713
Gene Nameproprotein convertase subtilisin/kexin type 5
SynonymsPC6, SPC6, b2b1549Clo, b2b585Clo, PC5A, PC5/6A
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6063 (G1)
Quality Score200.009
Status Not validated
Chromosome19
Chromosomal Location17432832-17837632 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 17454681 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025618]
Predicted Effect probably null
Transcript: ENSMUST00000025618
SMART Domains Protein: ENSMUSP00000025618
Gene: ENSMUSG00000024713

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
Pfam:S8_pro-domain 40 116 4.6e-27 PFAM
Pfam:Peptidase_S8 164 447 2.1e-46 PFAM
Pfam:P_proprotein 507 597 2.1e-33 PFAM
FU 632 682 4.92e-13 SMART
FU 685 732 4.84e-12 SMART
EGF_like 690 723 3.29e1 SMART
FU 736 779 1.29e-7 SMART
FU 781 826 5.74e-14 SMART
FU 834 881 2.23e-11 SMART
EGF_like 839 870 3.43e1 SMART
FU 884 929 1.84e-12 SMART
FU 931 981 1.47e-11 SMART
FU 984 1030 1e-4 SMART
EGF_like 989 1020 2.92e1 SMART
FU 1034 1079 5.04e-10 SMART
FU 1081 1123 3.08e-5 SMART
FU 1127 1168 4.88e-8 SMART
FU 1206 1248 2.7e-10 SMART
EGF_like 1211 1239 5.91e1 SMART
FU 1252 1299 1.48e-7 SMART
EGF 1264 1305 1.69e1 SMART
FU 1301 1345 2.31e-9 SMART
FU 1347 1390 8.98e-7 SMART
EGF_like 1352 1381 7.23e1 SMART
FU 1392 1438 1.04e-11 SMART
FU 1442 1487 6.8e-7 SMART
EGF 1447 1476 2.16e1 SMART
FU 1491 1536 3.37e-11 SMART
FU 1540 1585 9.32e-14 SMART
EGF_like 1545 1576 2.8e1 SMART
FU 1589 1636 1.39e-12 SMART
FU 1640 1685 6.49e-13 SMART
EGF_like 1645 1676 6.67e1 SMART
FU 1691 1738 7.01e-9 SMART
transmembrane domain 1770 1789 N/A INTRINSIC
low complexity region 1827 1840 N/A INTRINSIC
low complexity region 1858 1876 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subtilisin-like proprotein convertase that mediates posttranslational endoproteolytic processing of various proprotein substrates traversing the secretory pathway. The encoded protein is an inactive zymogen that undergoes autoproteolytic processing in the endoplasmic reticulum and the Golgi network to generate an active enzyme. Mice lacking the encoded protein die at an early embryonic stage. Conditional inactivation this gene in the epiblast but not in the extraembryonic tissue bypasses embryonic lethality but results in death at birth. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null mutation in this gene display embryonic lethality between E4.5-E7.5. Mice homozygous for ENU-induced mutations exhibit heterotaxia with congenital heart defects and immotile respiratory cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,264,344 R1713C unknown Het
Ano6 C T 15: 95,948,417 T512I probably damaging Het
Ap3s1 T C 18: 46,754,438 V46A probably benign Het
Art2a-ps C A 7: 101,555,206 V42F probably damaging Het
Asph C T 4: 9,531,960 V386M probably benign Het
B4galnt4 T A 7: 141,064,730 D179E probably benign Het
Bbx T C 16: 50,251,367 I232V probably benign Het
C1ql2 A G 1: 120,341,592 I159V probably benign Het
Ccar1 A G 10: 62,776,717 V223A possibly damaging Het
Cd2ap A T 17: 42,825,911 L277I probably benign Het
Cfap44 G A 16: 44,429,892 E778K probably benign Het
Chd3 A T 11: 69,349,237 D1626E probably benign Het
Crocc C T 4: 141,041,721 G505S probably benign Het
Crocc T A 4: 141,046,540 Q72L probably damaging Het
Drosha T C 15: 12,834,070 probably benign Het
Eps8l1 T A 7: 4,471,297 S256T possibly damaging Het
F830045P16Rik A G 2: 129,474,390 V133A probably damaging Het
Fermt2 A T 14: 45,459,881 M671K possibly damaging Het
Fhdc1 G A 3: 84,446,029 L630F probably benign Het
Gm9125 A G 3: 94,050,101 F7L probably benign Het
Gon4l T C 3: 88,899,999 S1667P probably damaging Het
Greb1l A C 18: 10,557,340 K1780T probably damaging Het
H2-Q10 C T 17: 35,470,129 T8M probably benign Het
Hmcn2 A T 2: 31,434,713 T4215S probably benign Het
I0C0044D17Rik G A 4: 98,820,339 probably benign Het
Ifi204 A G 1: 173,751,657 F541L probably benign Het
Igkv6-17 C T 6: 70,371,780 A45V probably damaging Het
Intu G A 3: 40,654,094 A161T probably damaging Het
Kcnmb2 A G 3: 32,178,992 Y73C probably damaging Het
Lrit1 T C 14: 37,054,988 F22L probably benign Het
Lrp1b A T 2: 41,284,144 C699* probably null Het
Lrrc8d A G 5: 105,812,126 D134G probably benign Het
Map1b T C 13: 99,431,137 D1692G unknown Het
Met C T 6: 17,491,968 S243F probably damaging Het
Mlph C A 1: 90,928,160 H96Q probably damaging Het
Mycbp2 A T 14: 103,135,146 V4088D probably damaging Het
Nampt T A 12: 32,848,659 S425T probably damaging Het
Nts G A 10: 102,484,995 H78Y probably benign Het
Nxf1 A G 19: 8,767,787 E467G possibly damaging Het
Olfml2a C A 2: 38,951,143 D230E probably benign Het
Olfr142 C A 2: 90,252,427 C187F probably benign Het
Olfr668 C T 7: 104,925,392 R124H probably benign Het
Pde5a C A 3: 122,824,925 T629K probably benign Het
Plcb3 G T 19: 6,962,834 R462S possibly damaging Het
Pnpla6 T A 8: 3,524,156 M469K probably benign Het
Pram1 A T 17: 33,641,412 K318* probably null Het
Prkd1 T C 12: 50,342,043 R906G probably benign Het
Ptprh T A 7: 4,573,362 T300S possibly damaging Het
Rdh16f2 A G 10: 127,876,874 Y247C probably benign Het
Rimbp3 A G 16: 17,210,917 E735G probably damaging Het
Sall3 G A 18: 80,974,255 P153S possibly damaging Het
Samd4b T A 7: 28,423,631 M1L possibly damaging Het
Sept12 T C 16: 4,992,263 E136G probably damaging Het
Shpk A T 11: 73,213,444 K140* probably null Het
Sidt1 G T 16: 44,259,466 F608L probably benign Het
Skint5 A G 4: 113,490,645 Y1300H probably benign Het
Slc22a28 G A 19: 8,117,022 P212S probably benign Het
Slc22a5 A T 11: 53,867,533 F480L possibly damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc3a1 C T 17: 85,028,523 P31L probably benign Het
Slc4a7 T C 14: 14,793,964 V1074A possibly damaging Het
Snx2 C T 18: 53,209,625 Q254* probably null Het
Sox30 G A 11: 45,991,942 V600I probably benign Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Tdrd7 A G 4: 46,005,486 T431A probably benign Het
Tenm2 A T 11: 36,163,717 probably null Het
Tigar A G 6: 127,091,201 S85P probably benign Het
Tnr A C 1: 159,912,684 M1143L probably benign Het
Trio G T 15: 27,891,379 Q429K possibly damaging Het
Urb1 T C 16: 90,789,097 I452M probably benign Het
Uroc1 A T 6: 90,347,928 E461V probably benign Het
Vax1 C A 19: 59,168,604 R99L unknown Het
Xab2 A T 8: 3,613,051 I510N possibly damaging Het
Zbtb34 A T 2: 33,411,830 I233K possibly damaging Het
Zfp27 A G 7: 29,894,302 F746S probably damaging Het
Zfp651 A G 9: 121,763,532 E306G probably benign Het
Zfp719 C T 7: 43,589,626 Q213* probably null Het
Zswim6 T C 13: 107,728,577 noncoding transcript Het
Other mutations in Pcsk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pcsk5 APN 19 17511421 missense possibly damaging 0.49
IGL00423:Pcsk5 APN 19 17642559 missense probably benign 0.23
IGL01315:Pcsk5 APN 19 17451958 missense probably damaging 1.00
IGL01372:Pcsk5 APN 19 17617744 missense probably damaging 1.00
IGL01738:Pcsk5 APN 19 17433780 splice site probably benign
IGL01874:Pcsk5 APN 19 17595677 missense probably damaging 0.96
IGL02070:Pcsk5 APN 19 17439042 missense probably benign 0.25
IGL02311:Pcsk5 APN 19 17433420 nonsense probably null
IGL02436:Pcsk5 APN 19 17564708 critical splice donor site probably null
IGL02498:Pcsk5 APN 19 17511556 missense probably damaging 0.99
IGL02504:Pcsk5 APN 19 17477872 critical splice donor site probably null
IGL02664:Pcsk5 APN 19 17456770 missense probably damaging 1.00
IGL02735:Pcsk5 APN 19 17675468 missense probably damaging 1.00
IGL02941:Pcsk5 APN 19 17447501 missense probably damaging 1.00
PIT4377001:Pcsk5 UTSW 19 17439102 missense probably damaging 1.00
R0007:Pcsk5 UTSW 19 17654861 missense probably damaging 1.00
R0007:Pcsk5 UTSW 19 17654861 missense probably damaging 1.00
R0032:Pcsk5 UTSW 19 17564815 missense possibly damaging 0.81
R0032:Pcsk5 UTSW 19 17564815 missense possibly damaging 0.81
R0373:Pcsk5 UTSW 19 17654849 missense probably damaging 1.00
R0784:Pcsk5 UTSW 19 17714769 missense probably benign 0.06
R0843:Pcsk5 UTSW 19 17654818 missense probably damaging 1.00
R1014:Pcsk5 UTSW 19 17564830 missense probably damaging 1.00
R1221:Pcsk5 UTSW 19 17837148 missense possibly damaging 0.85
R1435:Pcsk5 UTSW 19 17563882 nonsense probably null
R1471:Pcsk5 UTSW 19 17568324 missense probably damaging 1.00
R1564:Pcsk5 UTSW 19 17654756 missense probably damaging 1.00
R1597:Pcsk5 UTSW 19 17436600 missense probably benign 0.00
R1614:Pcsk5 UTSW 19 17515256 missense probably damaging 1.00
R1661:Pcsk5 UTSW 19 17447574 missense probably damaging 0.98
R1671:Pcsk5 UTSW 19 17454868 missense probably damaging 1.00
R1703:Pcsk5 UTSW 19 17752094 missense probably benign 0.15
R1793:Pcsk5 UTSW 19 17454750 missense possibly damaging 0.83
R1855:Pcsk5 UTSW 19 17515192 missense possibly damaging 0.93
R1909:Pcsk5 UTSW 19 17433461 missense probably benign 0.00
R1959:Pcsk5 UTSW 19 17433418 missense unknown
R2006:Pcsk5 UTSW 19 17477916 missense probably benign 0.32
R2045:Pcsk5 UTSW 19 17581144 missense possibly damaging 0.48
R2061:Pcsk5 UTSW 19 17454872 missense probably benign 0.03
R2110:Pcsk5 UTSW 19 17473059 missense probably damaging 1.00
R2402:Pcsk5 UTSW 19 17474834 nonsense probably null
R2496:Pcsk5 UTSW 19 17466158 nonsense probably null
R4115:Pcsk5 UTSW 19 17433419 missense unknown
R4504:Pcsk5 UTSW 19 17451955 missense probably damaging 1.00
R4616:Pcsk5 UTSW 19 17560750 missense probably benign 0.00
R4683:Pcsk5 UTSW 19 17473041 missense probably damaging 1.00
R4717:Pcsk5 UTSW 19 17525267 missense probably damaging 1.00
R4761:Pcsk5 UTSW 19 17837148 missense possibly damaging 0.85
R4789:Pcsk5 UTSW 19 17433599 missense probably benign 0.09
R4880:Pcsk5 UTSW 19 17447690 missense probably damaging 1.00
R5100:Pcsk5 UTSW 19 17515135 critical splice donor site probably null
R5114:Pcsk5 UTSW 19 17675585 missense probably damaging 1.00
R5116:Pcsk5 UTSW 19 17463434 missense possibly damaging 0.87
R5193:Pcsk5 UTSW 19 17564810 missense possibly damaging 0.79
R5279:Pcsk5 UTSW 19 17595658 splice site probably null
R5334:Pcsk5 UTSW 19 17461851 missense probably benign 0.00
R5369:Pcsk5 UTSW 19 17581255 missense probably damaging 1.00
R5451:Pcsk5 UTSW 19 17463356 missense possibly damaging 0.91
R5547:Pcsk5 UTSW 19 17752124 missense probably benign 0.08
R5630:Pcsk5 UTSW 19 17575831 missense probably benign 0.04
R5805:Pcsk5 UTSW 19 17456829 missense probably benign 0.01
R6130:Pcsk5 UTSW 19 17511556 missense probably damaging 0.99
R6153:Pcsk5 UTSW 19 17511492 missense probably damaging 0.98
R6163:Pcsk5 UTSW 19 17473041 missense probably damaging 1.00
R6164:Pcsk5 UTSW 19 17836953 critical splice donor site probably null
R6228:Pcsk5 UTSW 19 17581267 missense possibly damaging 0.91
R6426:Pcsk5 UTSW 19 17617729 missense probably damaging 1.00
R6601:Pcsk5 UTSW 19 17511380 missense probably benign 0.00
R6648:Pcsk5 UTSW 19 17575821 missense probably damaging 0.99
R6789:Pcsk5 UTSW 19 17456786 missense possibly damaging 0.93
R6807:Pcsk5 UTSW 19 17572622 splice site probably null
R6837:Pcsk5 UTSW 19 17439084 missense probably benign 0.01
R6998:Pcsk5 UTSW 19 17473112 missense probably benign 0.20
R7051:Pcsk5 UTSW 19 17433731 missense probably benign 0.00
R7164:Pcsk5 UTSW 19 17451985 missense probably damaging 1.00
R7173:Pcsk5 UTSW 19 17477877 missense possibly damaging 0.85
R7348:Pcsk5 UTSW 19 17456818 nonsense probably null
R7360:Pcsk5 UTSW 19 17515213 missense probably benign 0.00
R7407:Pcsk5 UTSW 19 17675516 missense probably damaging 1.00
R7447:Pcsk5 UTSW 19 17510236 missense probably benign 0.31
R7521:Pcsk5 UTSW 19 17454832 missense probably benign 0.29
R7525:Pcsk5 UTSW 19 17642590 missense probably damaging 1.00
R7560:Pcsk5 UTSW 19 17836972 missense probably benign 0.01
R7566:Pcsk5 UTSW 19 17572457 missense probably benign
R7631:Pcsk5 UTSW 19 17564780 missense probably damaging 1.00
R7654:Pcsk5 UTSW 19 17456804 missense possibly damaging 0.46
R7677:Pcsk5 UTSW 19 17581229 missense possibly damaging 0.59
R7711:Pcsk5 UTSW 19 17439080 missense possibly damaging 0.82
R7903:Pcsk5 UTSW 19 17572483 missense probably damaging 0.98
R7986:Pcsk5 UTSW 19 17572483 missense probably damaging 0.98
R8032:Pcsk5 UTSW 19 17714787 missense probably damaging 0.98
R8064:Pcsk5 UTSW 19 17714861 missense probably damaging 1.00
R8115:Pcsk5 UTSW 19 17510166 critical splice donor site probably null
X0023:Pcsk5 UTSW 19 17474872 missense possibly damaging 0.66
X0063:Pcsk5 UTSW 19 17447604 missense probably damaging 1.00
Z1088:Pcsk5 UTSW 19 17463374 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAGGGCAGAGTGTGATGTTTC -3'
(R):5'- GGCTTCACAGTAGTGCATGATG -3'

Posted On2017-07-14