Incidental Mutation 'R6063:Vax1'
ID483959
Institutional Source Beutler Lab
Gene Symbol Vax1
Ensembl Gene ENSMUSG00000006270
Gene Nameventral anterior homeobox 1
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.915) question?
Stock #R6063 (G1)
Quality Score183.009
Status Not validated
Chromosome19
Chromosomal Location59166187-59170056 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 59168604 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 99 (R99L)
Ref Sequence ENSEMBL: ENSMUSP00000134642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172821]
Predicted Effect unknown
Transcript: ENSMUST00000172821
AA Change: R99L
SMART Domains Protein: ENSMUSP00000134642
Gene: ENSMUSG00000006270
AA Change: R99L

DomainStartEndE-ValueType
HOX 100 162 1.34e-27 SMART
low complexity region 187 206 N/A INTRINSIC
low complexity region 208 245 N/A INTRINSIC
low complexity region 249 272 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173710
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the EMX homeobox protein family. The encoded protein functions as a transcription factor which is important in the development of anterior ventral forebrain and visual system. Disruption of this gene causes impairment in the developing forebrain, where the encoded protein is necessary for axon guidance and major tract formation. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous null mutants exhibit cleft palate and most die at birth. A few survive to 2 weeks of age. Mutants display defects in axon guidance, coloboma, dysgenesis of the optic nerve, defects of basal telencephalon, and holoprosencephaly. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G A 17: 24,264,344 R1713C unknown Het
Ano6 C T 15: 95,948,417 T512I probably damaging Het
Ap3s1 T C 18: 46,754,438 V46A probably benign Het
Art2a-ps C A 7: 101,555,206 V42F probably damaging Het
Asph C T 4: 9,531,960 V386M probably benign Het
B4galnt4 T A 7: 141,064,730 D179E probably benign Het
Bbx T C 16: 50,251,367 I232V probably benign Het
C1ql2 A G 1: 120,341,592 I159V probably benign Het
Ccar1 A G 10: 62,776,717 V223A possibly damaging Het
Cd2ap A T 17: 42,825,911 L277I probably benign Het
Cfap44 G A 16: 44,429,892 E778K probably benign Het
Chd3 A T 11: 69,349,237 D1626E probably benign Het
Crocc C T 4: 141,041,721 G505S probably benign Het
Crocc T A 4: 141,046,540 Q72L probably damaging Het
Drosha T C 15: 12,834,070 probably benign Het
Eps8l1 T A 7: 4,471,297 S256T possibly damaging Het
F830045P16Rik A G 2: 129,474,390 V133A probably damaging Het
Fermt2 A T 14: 45,459,881 M671K possibly damaging Het
Fhdc1 G A 3: 84,446,029 L630F probably benign Het
Gm9125 A G 3: 94,050,101 F7L probably benign Het
Gon4l T C 3: 88,899,999 S1667P probably damaging Het
Greb1l A C 18: 10,557,340 K1780T probably damaging Het
H2-Q10 C T 17: 35,470,129 T8M probably benign Het
Hmcn2 A T 2: 31,434,713 T4215S probably benign Het
I0C0044D17Rik G A 4: 98,820,339 probably benign Het
Ifi204 A G 1: 173,751,657 F541L probably benign Het
Igkv6-17 C T 6: 70,371,780 A45V probably damaging Het
Intu G A 3: 40,654,094 A161T probably damaging Het
Kcnmb2 A G 3: 32,178,992 Y73C probably damaging Het
Lrit1 T C 14: 37,054,988 F22L probably benign Het
Lrp1b A T 2: 41,284,144 C699* probably null Het
Lrrc8d A G 5: 105,812,126 D134G probably benign Het
Map1b T C 13: 99,431,137 D1692G unknown Het
Met C T 6: 17,491,968 S243F probably damaging Het
Mlph C A 1: 90,928,160 H96Q probably damaging Het
Mycbp2 A T 14: 103,135,146 V4088D probably damaging Het
Nampt T A 12: 32,848,659 S425T probably damaging Het
Nts G A 10: 102,484,995 H78Y probably benign Het
Nxf1 A G 19: 8,767,787 E467G possibly damaging Het
Olfml2a C A 2: 38,951,143 D230E probably benign Het
Olfr142 C A 2: 90,252,427 C187F probably benign Het
Olfr668 C T 7: 104,925,392 R124H probably benign Het
Pcsk5 A G 19: 17,454,681 probably null Het
Pde5a C A 3: 122,824,925 T629K probably benign Het
Plcb3 G T 19: 6,962,834 R462S possibly damaging Het
Pnpla6 T A 8: 3,524,156 M469K probably benign Het
Pram1 A T 17: 33,641,412 K318* probably null Het
Prkd1 T C 12: 50,342,043 R906G probably benign Het
Ptprh T A 7: 4,573,362 T300S possibly damaging Het
Rdh16f2 A G 10: 127,876,874 Y247C probably benign Het
Rimbp3 A G 16: 17,210,917 E735G probably damaging Het
Sall3 G A 18: 80,974,255 P153S possibly damaging Het
Samd4b T A 7: 28,423,631 M1L possibly damaging Het
Sept12 T C 16: 4,992,263 E136G probably damaging Het
Shpk A T 11: 73,213,444 K140* probably null Het
Sidt1 G T 16: 44,259,466 F608L probably benign Het
Skint5 A G 4: 113,490,645 Y1300H probably benign Het
Slc22a28 G A 19: 8,117,022 P212S probably benign Het
Slc22a5 A T 11: 53,867,533 F480L possibly damaging Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc3a1 C T 17: 85,028,523 P31L probably benign Het
Slc4a7 T C 14: 14,793,964 V1074A possibly damaging Het
Snx2 C T 18: 53,209,625 Q254* probably null Het
Sox30 G A 11: 45,991,942 V600I probably benign Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Tdrd7 A G 4: 46,005,486 T431A probably benign Het
Tenm2 A T 11: 36,163,717 probably null Het
Tigar A G 6: 127,091,201 S85P probably benign Het
Tnr A C 1: 159,912,684 M1143L probably benign Het
Trio G T 15: 27,891,379 Q429K possibly damaging Het
Urb1 T C 16: 90,789,097 I452M probably benign Het
Uroc1 A T 6: 90,347,928 E461V probably benign Het
Xab2 A T 8: 3,613,051 I510N possibly damaging Het
Zbtb34 A T 2: 33,411,830 I233K possibly damaging Het
Zfp27 A G 7: 29,894,302 F746S probably damaging Het
Zfp651 A G 9: 121,763,532 E306G probably benign Het
Zfp719 C T 7: 43,589,626 Q213* probably null Het
Zswim6 T C 13: 107,728,577 noncoding transcript Het
Other mutations in Vax1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4297:Vax1 UTSW 19 59166251 nonsense probably null
R5753:Vax1 UTSW 19 59166382 missense probably benign 0.13
R5897:Vax1 UTSW 19 59169801 missense unknown
R6378:Vax1 UTSW 19 59166224 missense probably benign 0.08
R6874:Vax1 UTSW 19 59168523 missense unknown
R7558:Vax1 UTSW 19 59169984 missense unknown
Predicted Primers PCR Primer
(F):5'- GGTCCAAAGCTAGGTAGATTGTG -3'
(R):5'- TTTATGATTGCGGCCACCCC -3'

Posted On2017-07-14