Incidental Mutation 'R6064:Rb1cc1'
ID483960
Institutional Source Beutler Lab
Gene Symbol Rb1cc1
Ensembl Gene ENSMUSG00000025907
Gene NameRB1-inducible coiled-coil 1
SynonymsCc1, 2900055E04Rik, LaXp180, 5930404L04Rik, Fip200
MMRRC Submission 044228-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6064 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location6206197-6276648 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6249734 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1126 (T1126A)
Ref Sequence ENSEMBL: ENSMUSP00000027040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027040] [ENSMUST00000162795]
Predicted Effect probably benign
Transcript: ENSMUST00000027040
AA Change: T1126A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027040
Gene: ENSMUSG00000025907
AA Change: T1126A

DomainStartEndE-ValueType
SCOP:d1euvb_ 1 51 7e-4 SMART
Blast:UBQ 3 76 8e-12 BLAST
low complexity region 471 486 N/A INTRINSIC
low complexity region 643 653 N/A INTRINSIC
low complexity region 658 674 N/A INTRINSIC
coiled coil region 859 921 N/A INTRINSIC
low complexity region 1033 1045 N/A INTRINSIC
low complexity region 1055 1066 N/A INTRINSIC
SCOP:d1eq1a_ 1159 1305 1e-3 SMART
low complexity region 1374 1388 N/A INTRINSIC
Pfam:ATG11 1447 1583 5.6e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159802
Predicted Effect unknown
Transcript: ENSMUST00000161327
AA Change: T1005A
SMART Domains Protein: ENSMUSP00000125348
Gene: ENSMUSG00000025907
AA Change: T1005A

DomainStartEndE-ValueType
low complexity region 351 366 N/A INTRINSIC
low complexity region 523 533 N/A INTRINSIC
low complexity region 538 554 N/A INTRINSIC
coiled coil region 738 800 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
low complexity region 935 946 N/A INTRINSIC
SCOP:d1eq1a_ 1039 1174 3e-3 SMART
low complexity region 1254 1268 N/A INTRINSIC
Pfam:ATG11 1327 1463 6.7e-28 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000162257
AA Change: T216A
SMART Domains Protein: ENSMUSP00000125334
Gene: ENSMUSG00000025907
AA Change: T216A

DomainStartEndE-ValueType
coiled coil region 33 331 N/A INTRINSIC
low complexity region 335 355 N/A INTRINSIC
coiled coil region 363 483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162795
SMART Domains Protein: ENSMUSP00000124676
Gene: ENSMUSG00000025907

DomainStartEndE-ValueType
SCOP:d1euvb_ 1 51 2e-4 SMART
Blast:UBQ 3 76 4e-12 BLAST
low complexity region 454 469 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 641 657 N/A INTRINSIC
coiled coil region 842 865 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with signaling pathways to coordinately regulate cell growth, cell proliferation, apoptosis, autophagy, and cell migration. This tumor suppressor also enhances retinoblastoma 1 gene expression in cancer cells. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality at mid/late gestation associated with heart failure and liver degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 C T 5: 49,960,325 D1294N probably damaging Het
Atf1 A G 15: 100,252,148 T92A probably benign Het
Bach1 A G 16: 87,729,864 D738G probably damaging Het
Catsper3 T C 13: 55,806,252 F278L probably damaging Het
Chsy3 GT G 18: 59,176,166 probably null Het
Cmya5 T A 13: 93,089,649 N2977I probably damaging Het
Cnbd1 T A 4: 18,895,084 E219D probably benign Het
Dst A G 1: 34,194,051 D3556G probably damaging Het
Duox1 A G 2: 122,320,762 E306G probably benign Het
Fstl5 T A 3: 76,322,298 F135L probably benign Het
Fyb A C 15: 6,638,868 K514T probably damaging Het
Gsap T A 5: 21,229,225 C280S possibly damaging Het
Lrig1 T C 6: 94,626,447 E240G probably damaging Het
Macc1 A T 12: 119,445,665 H56L probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Muc6 T C 7: 141,648,374 R696G probably damaging Het
Nup210 T C 6: 91,055,291 I32V probably benign Het
Olfr1155 A G 2: 87,943,484 M48T probably benign Het
Olfr183 T G 16: 58,999,823 I46S probably damaging Het
Olfr668 C T 7: 104,925,392 R124H probably benign Het
Ovch2 T C 7: 107,796,572 T80A probably damaging Het
Rad51ap2 T A 12: 11,457,417 Y447N possibly damaging Het
Scgb1b10 T C 7: 32,101,202 L72S probably damaging Het
Slc25a33 A G 4: 149,752,464 V141A probably benign Het
Tbx21 T C 11: 97,114,911 Y76C probably damaging Het
Tmem235 T C 11: 117,862,938 V107A possibly damaging Het
Vnn1 G T 10: 23,894,909 A12S probably benign Het
Zfp606 T G 7: 12,481,033 W63G possibly damaging Het
Zfp788 T A 7: 41,648,454 F119L probably benign Het
Other mutations in Rb1cc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Rb1cc1 APN 1 6249506 missense probably damaging 0.97
IGL00590:Rb1cc1 APN 1 6238296 missense probably damaging 1.00
IGL00678:Rb1cc1 APN 1 6234085 missense probably damaging 1.00
IGL00705:Rb1cc1 APN 1 6244133 missense probably benign 0.00
IGL00957:Rb1cc1 APN 1 6249539 missense probably damaging 1.00
IGL01363:Rb1cc1 APN 1 6250109 missense probably benign 0.06
IGL01599:Rb1cc1 APN 1 6248771 nonsense probably null
IGL01610:Rb1cc1 APN 1 6248481 missense probably benign 0.03
IGL01929:Rb1cc1 APN 1 6240159 missense possibly damaging 0.82
IGL01978:Rb1cc1 APN 1 6238368 missense probably damaging 1.00
IGL02312:Rb1cc1 APN 1 6265623 critical splice donor site probably null
IGL02471:Rb1cc1 APN 1 6240051 missense probably benign 0.01
IGL02677:Rb1cc1 APN 1 6249419 missense probably benign
IGL02702:Rb1cc1 APN 1 6240023 missense probably damaging 0.99
IGL02816:Rb1cc1 APN 1 6262828 splice site probably benign
IGL02899:Rb1cc1 APN 1 6264583 missense probably damaging 1.00
fingerling UTSW 1 6261032 missense probably damaging 1.00
tots UTSW 1 6245637 missense probably damaging 0.99
IGL02988:Rb1cc1 UTSW 1 6247811 critical splice donor site probably null
R0020:Rb1cc1 UTSW 1 6264548 missense possibly damaging 0.86
R0254:Rb1cc1 UTSW 1 6262847 missense probably damaging 1.00
R0390:Rb1cc1 UTSW 1 6248634 missense probably damaging 1.00
R0466:Rb1cc1 UTSW 1 6263267 splice site probably null
R0482:Rb1cc1 UTSW 1 6240323 missense probably damaging 1.00
R0510:Rb1cc1 UTSW 1 6249171 missense probably benign 0.00
R0512:Rb1cc1 UTSW 1 6248543 missense probably damaging 1.00
R0616:Rb1cc1 UTSW 1 6244262 missense possibly damaging 0.80
R0617:Rb1cc1 UTSW 1 6248790 missense possibly damaging 0.83
R0837:Rb1cc1 UTSW 1 6234271 splice site probably null
R1399:Rb1cc1 UTSW 1 6249818 missense probably benign 0.00
R1532:Rb1cc1 UTSW 1 6249734 missense probably benign 0.00
R1542:Rb1cc1 UTSW 1 6244249 missense possibly damaging 0.82
R1746:Rb1cc1 UTSW 1 6263013 splice site probably null
R1764:Rb1cc1 UTSW 1 6214680 intron probably benign
R1968:Rb1cc1 UTSW 1 6248195 splice site probably null
R2025:Rb1cc1 UTSW 1 6245309 missense probably damaging 1.00
R2076:Rb1cc1 UTSW 1 6250038 missense possibly damaging 0.82
R2101:Rb1cc1 UTSW 1 6249335 missense probably benign
R2249:Rb1cc1 UTSW 1 6272724 missense probably damaging 1.00
R3176:Rb1cc1 UTSW 1 6249366 missense probably benign
R3276:Rb1cc1 UTSW 1 6249366 missense probably benign
R3716:Rb1cc1 UTSW 1 6270690 critical splice acceptor site probably null
R3747:Rb1cc1 UTSW 1 6248742 missense possibly damaging 0.92
R3850:Rb1cc1 UTSW 1 6250113 missense probably benign 0.22
R3967:Rb1cc1 UTSW 1 6248270 splice site probably benign
R3969:Rb1cc1 UTSW 1 6248270 splice site probably benign
R3972:Rb1cc1 UTSW 1 6249000 missense probably benign 0.00
R4166:Rb1cc1 UTSW 1 6265663 intron probably benign
R4168:Rb1cc1 UTSW 1 6230024 missense probably damaging 1.00
R4358:Rb1cc1 UTSW 1 6245637 missense probably damaging 0.99
R4370:Rb1cc1 UTSW 1 6248547 missense probably damaging 1.00
R4869:Rb1cc1 UTSW 1 6215021 intron probably benign
R4945:Rb1cc1 UTSW 1 6249627 missense probably benign 0.24
R5111:Rb1cc1 UTSW 1 6214634 intron probably benign
R5175:Rb1cc1 UTSW 1 6248321 missense probably benign
R5196:Rb1cc1 UTSW 1 6234230 missense probably damaging 0.99
R5271:Rb1cc1 UTSW 1 6249193 nonsense probably null
R5341:Rb1cc1 UTSW 1 6215042 intron probably benign
R5952:Rb1cc1 UTSW 1 6248182 missense probably benign
R5992:Rb1cc1 UTSW 1 6233996 missense probably damaging 1.00
R6054:Rb1cc1 UTSW 1 6249834 missense probably benign 0.01
R6313:Rb1cc1 UTSW 1 6244133 missense probably benign 0.00
R6345:Rb1cc1 UTSW 1 6263257 missense probably benign 0.00
R6488:Rb1cc1 UTSW 1 6270727 missense probably damaging 0.97
R6566:Rb1cc1 UTSW 1 6249092 missense probably benign 0.15
R6739:Rb1cc1 UTSW 1 6234230 missense probably damaging 0.99
R6829:Rb1cc1 UTSW 1 6249264 missense probably benign 0.04
R6945:Rb1cc1 UTSW 1 6261032 missense probably damaging 1.00
R6976:Rb1cc1 UTSW 1 6262902 missense probably benign 0.01
R7031:Rb1cc1 UTSW 1 6238466 critical splice donor site probably null
R7066:Rb1cc1 UTSW 1 6250005 missense possibly damaging 0.69
R7185:Rb1cc1 UTSW 1 6238383 missense probably damaging 1.00
R7276:Rb1cc1 UTSW 1 6249192 missense probably benign 0.13
R7448:Rb1cc1 UTSW 1 6245503 missense probably damaging 1.00
R7463:Rb1cc1 UTSW 1 6249180 missense probably benign
R7484:Rb1cc1 UTSW 1 6274217 missense probably damaging 1.00
R7496:Rb1cc1 UTSW 1 6248191 missense probably null 0.02
R7618:Rb1cc1 UTSW 1 6265558 splice site probably null
R7681:Rb1cc1 UTSW 1 6240323 missense probably damaging 1.00
R7774:Rb1cc1 UTSW 1 6248085 missense possibly damaging 0.63
R7780:Rb1cc1 UTSW 1 6248914 nonsense probably null
R7947:Rb1cc1 UTSW 1 6248562 missense probably damaging 1.00
R8057:Rb1cc1 UTSW 1 6245219 missense probably damaging 1.00
R8094:Rb1cc1 UTSW 1 6263224 nonsense probably null
Z1088:Rb1cc1 UTSW 1 6249018 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACAGCTGCAGGAGTTGAAAC -3'
(R):5'- CAATTCTGAGTTCAATCTAGTCTGC -3'

Sequencing Primer
(F):5'- TCTGACTTGTCAGACATGAGATG -3'
(R):5'- CTGAGTTCAATCTAGTCTGCAATTC -3'
Posted On2017-07-14