Incidental Mutation 'R6064:Zfp606'
ID483972
Institutional Source Beutler Lab
Gene Symbol Zfp606
Ensembl Gene ENSMUSG00000030386
Gene Namezinc finger protein 606
Synonyms2410022M24Rik
MMRRC Submission 044228-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R6064 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location12478293-12496235 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 12481033 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Glycine at position 63 (W63G)
Ref Sequence ENSEMBL: ENSMUSP00000147558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098822] [ENSMUST00000123589] [ENSMUST00000151933] [ENSMUST00000209403]
Predicted Effect probably benign
Transcript: ENSMUST00000098822
SMART Domains Protein: ENSMUSP00000096421
Gene: ENSMUSG00000030386

DomainStartEndE-ValueType
KRAB 63 123 3.36e-39 SMART
ZnF_C2H2 291 313 1.83e2 SMART
ZnF_C2H2 403 425 2.89e1 SMART
ZnF_C2H2 431 453 2.3e-5 SMART
ZnF_C2H2 459 481 1.28e-3 SMART
ZnF_C2H2 487 509 3.95e-4 SMART
ZnF_C2H2 515 537 5.67e-5 SMART
ZnF_C2H2 543 565 6.88e-4 SMART
ZnF_C2H2 571 593 9.22e-5 SMART
ZnF_C2H2 599 621 1.95e-3 SMART
ZnF_C2H2 627 649 1.47e-3 SMART
ZnF_C2H2 655 677 3.39e-3 SMART
ZnF_C2H2 683 705 4.11e-2 SMART
ZnF_C2H2 711 733 4.87e-4 SMART
ZnF_C2H2 739 761 1.67e-2 SMART
ZnF_C2H2 767 789 2.4e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000123589
AA Change: W63G

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000151933
SMART Domains Protein: ENSMUSP00000122197
Gene: ENSMUSG00000030386

DomainStartEndE-ValueType
KRAB 5 65 3.36e-39 SMART
ZnF_C2H2 233 255 1.83e2 SMART
ZnF_C2H2 345 367 2.89e1 SMART
ZnF_C2H2 373 395 2.3e-5 SMART
ZnF_C2H2 401 423 1.28e-3 SMART
ZnF_C2H2 429 451 3.95e-4 SMART
ZnF_C2H2 457 479 5.67e-5 SMART
ZnF_C2H2 485 507 6.88e-4 SMART
ZnF_C2H2 513 535 9.22e-5 SMART
ZnF_C2H2 541 563 1.95e-3 SMART
ZnF_C2H2 569 591 1.47e-3 SMART
ZnF_C2H2 597 619 3.39e-3 SMART
ZnF_C2H2 625 647 4.11e-2 SMART
ZnF_C2H2 653 675 4.87e-4 SMART
ZnF_C2H2 681 703 1.67e-2 SMART
ZnF_C2H2 709 731 2.4e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209403
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein containing a Kruppel-associated box (KRAB) domain at its N-terminus, followed by contiguous C2H2 zinc finger motifs. The encoded protein is a nuclear protein that can act as a transcriptional repressor of growth factor-mediated signaling pathways in a reporter gene assay. This protein has been shown to interact with the SRY-box 9 gene product, and suppresses its transcriptional activity by inhibiting its DNA binding activity. Reduced expression of this gene promotes chondrocyte differentiation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 C T 5: 49,960,325 D1294N probably damaging Het
Atf1 A G 15: 100,252,148 T92A probably benign Het
Bach1 A G 16: 87,729,864 D738G probably damaging Het
Catsper3 T C 13: 55,806,252 F278L probably damaging Het
Chsy3 GT G 18: 59,176,166 probably null Het
Cmya5 T A 13: 93,089,649 N2977I probably damaging Het
Cnbd1 T A 4: 18,895,084 E219D probably benign Het
Dst A G 1: 34,194,051 D3556G probably damaging Het
Duox1 A G 2: 122,320,762 E306G probably benign Het
Fstl5 T A 3: 76,322,298 F135L probably benign Het
Fyb A C 15: 6,638,868 K514T probably damaging Het
Gsap T A 5: 21,229,225 C280S possibly damaging Het
Lrig1 T C 6: 94,626,447 E240G probably damaging Het
Macc1 A T 12: 119,445,665 H56L probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Muc6 T C 7: 141,648,374 R696G probably damaging Het
Nup210 T C 6: 91,055,291 I32V probably benign Het
Olfr1155 A G 2: 87,943,484 M48T probably benign Het
Olfr183 T G 16: 58,999,823 I46S probably damaging Het
Olfr668 C T 7: 104,925,392 R124H probably benign Het
Ovch2 T C 7: 107,796,572 T80A probably damaging Het
Rad51ap2 T A 12: 11,457,417 Y447N possibly damaging Het
Rb1cc1 A G 1: 6,249,734 T1126A probably benign Het
Scgb1b10 T C 7: 32,101,202 L72S probably damaging Het
Slc25a33 A G 4: 149,752,464 V141A probably benign Het
Tbx21 T C 11: 97,114,911 Y76C probably damaging Het
Tmem235 T C 11: 117,862,938 V107A possibly damaging Het
Vnn1 G T 10: 23,894,909 A12S probably benign Het
Zfp788 T A 7: 41,648,454 F119L probably benign Het
Other mutations in Zfp606
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1680:Zfp606 UTSW 7 12493971 missense probably damaging 1.00
R1861:Zfp606 UTSW 7 12480931 unclassified probably benign
R1943:Zfp606 UTSW 7 12493688 missense probably damaging 1.00
R2142:Zfp606 UTSW 7 12479726 missense probably damaging 0.99
R2340:Zfp606 UTSW 7 12493089 missense possibly damaging 0.91
R3426:Zfp606 UTSW 7 12489664 missense probably damaging 0.99
R4208:Zfp606 UTSW 7 12494175 missense probably damaging 1.00
R4258:Zfp606 UTSW 7 12494340 splice site probably null
R4383:Zfp606 UTSW 7 12494001 missense probably damaging 1.00
R4393:Zfp606 UTSW 7 12492849 missense probably damaging 1.00
R4782:Zfp606 UTSW 7 12494005 missense probably damaging 1.00
R4858:Zfp606 UTSW 7 12493056 missense possibly damaging 0.89
R5668:Zfp606 UTSW 7 12492552 missense probably benign 0.28
R5704:Zfp606 UTSW 7 12493529 missense probably damaging 0.99
R6080:Zfp606 UTSW 7 12494116 missense probably damaging 1.00
R6190:Zfp606 UTSW 7 12494001 missense probably damaging 1.00
R6383:Zfp606 UTSW 7 12492944 missense probably benign 0.18
R6964:Zfp606 UTSW 7 12489592 missense probably damaging 1.00
R7193:Zfp606 UTSW 7 12494039 missense probably benign 0.32
R7507:Zfp606 UTSW 7 12492941 missense probably benign 0.18
R7997:Zfp606 UTSW 7 12489592 missense probably damaging 1.00
R7997:Zfp606 UTSW 7 12494207 missense possibly damaging 0.86
R8078:Zfp606 UTSW 7 12481015 missense possibly damaging 0.85
R8209:Zfp606 UTSW 7 12493307 missense probably benign 0.13
R8254:Zfp606 UTSW 7 12492861 missense possibly damaging 0.51
Z1176:Zfp606 UTSW 7 12481025 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTTACTGGTGATGGTAGGAGC -3'
(R):5'- GTGACAGCAAAGCTCTGTATCATAG -3'

Sequencing Primer
(F):5'- AGCAGGGCCTCGTACTTCTC -3'
(R):5'- GCTCTGTATCATAGAAAACTGACTGG -3'
Posted On2017-07-14