Incidental Mutation 'R6064:Scgb1b10'
ID483973
Institutional Source Beutler Lab
Gene Symbol Scgb1b10
Ensembl Gene ENSMUSG00000099581
Gene Namesecretoglobin, family 1B, member 10
SynonymsGm4384, Abpa10
MMRRC Submission 044228-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R6064 (G1)
Quality Score179.009
Status Not validated
Chromosome7
Chromosomal Location32100853-32102169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32101202 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 72 (L72S)
Ref Sequence ENSEMBL: ENSMUSP00000139939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000187257]
Predicted Effect probably damaging
Transcript: ENSMUST00000187257
AA Change: L72S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139939
Gene: ENSMUSG00000099581
AA Change: L72S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
UTG 24 93 1.9e-19 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 C T 5: 49,960,325 D1294N probably damaging Het
Atf1 A G 15: 100,252,148 T92A probably benign Het
Bach1 A G 16: 87,729,864 D738G probably damaging Het
Catsper3 T C 13: 55,806,252 F278L probably damaging Het
Chsy3 GT G 18: 59,176,166 probably null Het
Cmya5 T A 13: 93,089,649 N2977I probably damaging Het
Cnbd1 T A 4: 18,895,084 E219D probably benign Het
Dst A G 1: 34,194,051 D3556G probably damaging Het
Duox1 A G 2: 122,320,762 E306G probably benign Het
Fstl5 T A 3: 76,322,298 F135L probably benign Het
Fyb A C 15: 6,638,868 K514T probably damaging Het
Gsap T A 5: 21,229,225 C280S possibly damaging Het
Lrig1 T C 6: 94,626,447 E240G probably damaging Het
Macc1 A T 12: 119,445,665 H56L probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Muc6 T C 7: 141,648,374 R696G probably damaging Het
Nup210 T C 6: 91,055,291 I32V probably benign Het
Olfr1155 A G 2: 87,943,484 M48T probably benign Het
Olfr183 T G 16: 58,999,823 I46S probably damaging Het
Olfr668 C T 7: 104,925,392 R124H probably benign Het
Ovch2 T C 7: 107,796,572 T80A probably damaging Het
Rad51ap2 T A 12: 11,457,417 Y447N possibly damaging Het
Rb1cc1 A G 1: 6,249,734 T1126A probably benign Het
Slc25a33 A G 4: 149,752,464 V141A probably benign Het
Tbx21 T C 11: 97,114,911 Y76C probably damaging Het
Tmem235 T C 11: 117,862,938 V107A possibly damaging Het
Vnn1 G T 10: 23,894,909 A12S probably benign Het
Zfp606 T G 7: 12,481,033 W63G possibly damaging Het
Zfp788 T A 7: 41,648,454 F119L probably benign Het
Other mutations in Scgb1b10
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4976:Scgb1b10 UTSW 7 32101184 missense possibly damaging 0.51
R5659:Scgb1b10 UTSW 7 32100878 missense probably benign 0.13
R6989:Scgb1b10 UTSW 7 32101149 missense probably benign 0.32
R7947:Scgb1b10 UTSW 7 32101145 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGGTCTTTCAAGTGAGGGTC -3'
(R):5'- CTACTGTGGCTTAGCTGAGCTG -3'

Sequencing Primer
(F):5'- GGGTCACCTTTTCTTTGTGTTCCAG -3'
(R):5'- TGAGCAGCCAGAGCCAG -3'
Posted On2017-07-14