Incidental Mutation 'R6064:Ovch2'
ID 483976
Institutional Source Beutler Lab
Gene Symbol Ovch2
Ensembl Gene ENSMUSG00000048236
Gene Name ovochymase 2
Synonyms 9230106D23Rik
MMRRC Submission 044228-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6064 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 107380751-107400386 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 107395779 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 80 (T80A)
Ref Sequence ENSEMBL: ENSMUSP00000102366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106755]
AlphaFold Q7M761
Predicted Effect probably damaging
Transcript: ENSMUST00000106755
AA Change: T80A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000102366
Gene: ENSMUSG00000048236
AA Change: T80A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Tryp_SPc 51 294 6.58e-93 SMART
CUB 314 421 1.68e-17 SMART
CUB 431 543 5.02e-25 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 C T 5: 50,117,667 (GRCm39) D1294N probably damaging Het
Atf1 A G 15: 100,150,029 (GRCm39) T92A probably benign Het
Bach1 A G 16: 87,526,752 (GRCm39) D738G probably damaging Het
Catsper3 T C 13: 55,954,065 (GRCm39) F278L probably damaging Het
Chsy3 GT G 18: 59,309,238 (GRCm39) 163 probably null Het
Cmya5 T A 13: 93,226,157 (GRCm39) N2977I probably damaging Het
Cnbd1 T A 4: 18,895,084 (GRCm39) E219D probably benign Het
Dst A G 1: 34,233,132 (GRCm39) D3556G probably damaging Het
Duox1 A G 2: 122,151,243 (GRCm39) E306G probably benign Het
Fstl5 T A 3: 76,229,605 (GRCm39) F135L probably benign Het
Fyb1 A C 15: 6,668,349 (GRCm39) K514T probably damaging Het
Gsap T A 5: 21,434,223 (GRCm39) C280S possibly damaging Het
Lrig1 T C 6: 94,603,428 (GRCm39) E240G probably damaging Het
Macc1 A T 12: 119,409,400 (GRCm39) H56L probably benign Het
Mroh2a GCCC GC 1: 88,159,979 (GRCm39) probably null Het
Muc6 T C 7: 141,234,640 (GRCm39) R696G probably damaging Het
Nup210 T C 6: 91,032,273 (GRCm39) I32V probably benign Het
Or52n2c C T 7: 104,574,599 (GRCm39) R124H probably benign Het
Or5d16 A G 2: 87,773,828 (GRCm39) M48T probably benign Het
Or5h17 T G 16: 58,820,186 (GRCm39) I46S probably damaging Het
Rad51ap2 T A 12: 11,507,418 (GRCm39) Y447N possibly damaging Het
Rb1cc1 A G 1: 6,319,958 (GRCm39) T1126A probably benign Het
Scgb1b10 T C 7: 31,800,627 (GRCm39) L72S probably damaging Het
Slc25a33 A G 4: 149,836,921 (GRCm39) V141A probably benign Het
Tbx21 T C 11: 97,005,737 (GRCm39) Y76C probably damaging Het
Tmem235 T C 11: 117,753,764 (GRCm39) V107A possibly damaging Het
Vnn1 G T 10: 23,770,807 (GRCm39) A12S probably benign Het
Zfp606 T G 7: 12,214,960 (GRCm39) W63G possibly damaging Het
Zfp788 T A 7: 41,297,878 (GRCm39) F119L probably benign Het
Other mutations in Ovch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Ovch2 APN 7 107,388,297 (GRCm39) missense probably null 1.00
IGL02198:Ovch2 APN 7 107,394,041 (GRCm39) missense probably damaging 0.99
IGL02200:Ovch2 APN 7 107,394,030 (GRCm39) missense probably damaging 1.00
IGL02442:Ovch2 APN 7 107,395,755 (GRCm39) missense possibly damaging 0.90
IGL02531:Ovch2 APN 7 107,389,405 (GRCm39) missense probably damaging 1.00
IGL02862:Ovch2 APN 7 107,394,138 (GRCm39) missense probably damaging 1.00
R0401:Ovch2 UTSW 7 107,400,343 (GRCm39) missense probably damaging 0.98
R0413:Ovch2 UTSW 7 107,381,243 (GRCm39) missense probably benign
R0631:Ovch2 UTSW 7 107,381,228 (GRCm39) missense probably benign 0.01
R1028:Ovch2 UTSW 7 107,395,755 (GRCm39) missense probably benign 0.37
R1329:Ovch2 UTSW 7 107,384,653 (GRCm39) missense probably damaging 1.00
R1809:Ovch2 UTSW 7 107,389,412 (GRCm39) critical splice acceptor site probably null
R2254:Ovch2 UTSW 7 107,389,402 (GRCm39) missense probably benign 0.02
R2265:Ovch2 UTSW 7 107,383,782 (GRCm39) missense probably damaging 1.00
R2358:Ovch2 UTSW 7 107,394,122 (GRCm39) missense probably damaging 1.00
R2922:Ovch2 UTSW 7 107,389,596 (GRCm39) missense possibly damaging 0.88
R2923:Ovch2 UTSW 7 107,389,596 (GRCm39) missense possibly damaging 0.88
R3034:Ovch2 UTSW 7 107,384,699 (GRCm39) missense probably damaging 1.00
R3885:Ovch2 UTSW 7 107,395,775 (GRCm39) missense probably damaging 1.00
R3957:Ovch2 UTSW 7 107,388,318 (GRCm39) missense probably damaging 0.99
R4687:Ovch2 UTSW 7 107,395,755 (GRCm39) missense possibly damaging 0.90
R5307:Ovch2 UTSW 7 107,391,341 (GRCm39) missense probably benign 0.26
R5353:Ovch2 UTSW 7 107,393,631 (GRCm39) missense probably damaging 0.98
R5688:Ovch2 UTSW 7 107,393,201 (GRCm39) missense probably damaging 1.00
R5730:Ovch2 UTSW 7 107,392,606 (GRCm39) missense probably damaging 1.00
R5767:Ovch2 UTSW 7 107,381,185 (GRCm39) missense probably benign
R5979:Ovch2 UTSW 7 107,393,595 (GRCm39) missense possibly damaging 0.94
R6039:Ovch2 UTSW 7 107,388,318 (GRCm39) missense probably damaging 0.99
R6039:Ovch2 UTSW 7 107,388,318 (GRCm39) missense probably damaging 0.99
R6247:Ovch2 UTSW 7 107,384,648 (GRCm39) missense probably damaging 1.00
R6638:Ovch2 UTSW 7 107,388,301 (GRCm39) missense probably benign 0.17
R6877:Ovch2 UTSW 7 107,389,315 (GRCm39) missense probably benign 0.25
R7040:Ovch2 UTSW 7 107,395,772 (GRCm39) missense probably damaging 1.00
R7257:Ovch2 UTSW 7 107,393,640 (GRCm39) missense probably damaging 1.00
R7282:Ovch2 UTSW 7 107,393,577 (GRCm39) missense possibly damaging 0.94
R7824:Ovch2 UTSW 7 107,388,295 (GRCm39) critical splice donor site probably null
R7841:Ovch2 UTSW 7 107,393,298 (GRCm39) missense probably benign 0.01
R7908:Ovch2 UTSW 7 107,388,326 (GRCm39) missense probably damaging 1.00
R8427:Ovch2 UTSW 7 107,393,207 (GRCm39) missense probably damaging 1.00
R8745:Ovch2 UTSW 7 107,389,584 (GRCm39) missense possibly damaging 0.93
R8812:Ovch2 UTSW 7 107,393,251 (GRCm39) nonsense probably null
R8812:Ovch2 UTSW 7 107,392,462 (GRCm39) missense probably damaging 1.00
R9250:Ovch2 UTSW 7 107,392,542 (GRCm39) missense probably damaging 1.00
R9301:Ovch2 UTSW 7 107,395,815 (GRCm39) missense probably damaging 1.00
R9308:Ovch2 UTSW 7 107,389,560 (GRCm39) missense probably benign 0.03
R9703:Ovch2 UTSW 7 107,383,777 (GRCm39) missense probably damaging 1.00
R9717:Ovch2 UTSW 7 107,393,584 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCTCATTTGTGACACCC -3'
(R):5'- TGAAGTTGTAGGGGTCAAATAGTC -3'

Sequencing Primer
(F):5'- AGCCTCATTTGTGACACCCAATTATC -3'
(R):5'- AGTAGGCCCAAACTACTCTTG -3'
Posted On 2017-07-14