Incidental Mutation 'R6064:Vnn1'
ID483978
Institutional Source Beutler Lab
Gene Symbol Vnn1
Ensembl Gene ENSMUSG00000037440
Gene Namevanin 1
SynonymsV-1, pantetheinase
MMRRC Submission 044228-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R6064 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location23894688-23905343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 23894909 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 12 (A12S)
Ref Sequence ENSEMBL: ENSMUSP00000040599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041416]
Predicted Effect probably benign
Transcript: ENSMUST00000041416
AA Change: A12S

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000040599
Gene: ENSMUSG00000037440
AA Change: A12S

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:CN_hydrolase 52 279 2.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219254
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vanin family of proteins, which share extensive sequence similarity with each other, and also with biotinidase. The family includes secreted and membrane-associated proteins, a few of which have been reported to participate in hematopoietic cell trafficking. No biotinidase activity has been demonstrated for any of the vanin proteins, however, they possess pantetheinase activity, which may play a role in oxidative-stress response. This protein, like its mouse homolog, is likely a GPI-anchored cell surface molecule. The mouse protein is expressed by the perivascular thymic stromal cells and regulates migration of T-cell progenitors to the thymus. This gene lies in close proximity to, and in the same transcriptional orientation as, two other vanin genes on chromosome 6q23-q24. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for disruptions of this gene develop normally and so no abnormalities in the maturation of lymphoid organs. However, membrane bound pantetheinase is absent in livers and kidneys resuulting in an absence of cysteamine in these organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 C T 5: 49,960,325 D1294N probably damaging Het
Atf1 A G 15: 100,252,148 T92A probably benign Het
Bach1 A G 16: 87,729,864 D738G probably damaging Het
Catsper3 T C 13: 55,806,252 F278L probably damaging Het
Chsy3 GT G 18: 59,176,166 probably null Het
Cmya5 T A 13: 93,089,649 N2977I probably damaging Het
Cnbd1 T A 4: 18,895,084 E219D probably benign Het
Dst A G 1: 34,194,051 D3556G probably damaging Het
Duox1 A G 2: 122,320,762 E306G probably benign Het
Fstl5 T A 3: 76,322,298 F135L probably benign Het
Fyb A C 15: 6,638,868 K514T probably damaging Het
Gsap T A 5: 21,229,225 C280S possibly damaging Het
Lrig1 T C 6: 94,626,447 E240G probably damaging Het
Macc1 A T 12: 119,445,665 H56L probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Muc6 T C 7: 141,648,374 R696G probably damaging Het
Nup210 T C 6: 91,055,291 I32V probably benign Het
Olfr1155 A G 2: 87,943,484 M48T probably benign Het
Olfr183 T G 16: 58,999,823 I46S probably damaging Het
Olfr668 C T 7: 104,925,392 R124H probably benign Het
Ovch2 T C 7: 107,796,572 T80A probably damaging Het
Rad51ap2 T A 12: 11,457,417 Y447N possibly damaging Het
Rb1cc1 A G 1: 6,249,734 T1126A probably benign Het
Scgb1b10 T C 7: 32,101,202 L72S probably damaging Het
Slc25a33 A G 4: 149,752,464 V141A probably benign Het
Tbx21 T C 11: 97,114,911 Y76C probably damaging Het
Tmem235 T C 11: 117,862,938 V107A possibly damaging Het
Zfp606 T G 7: 12,481,033 W63G possibly damaging Het
Zfp788 T A 7: 41,648,454 F119L probably benign Het
Other mutations in Vnn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Vnn1 APN 10 23900779 missense possibly damaging 0.51
IGL01299:Vnn1 APN 10 23895051 missense probably damaging 1.00
IGL01353:Vnn1 APN 10 23900840 missense probably damaging 1.00
IGL01774:Vnn1 APN 10 23900710 missense probably benign 0.26
IGL01970:Vnn1 APN 10 23897402 missense probably benign 0.06
IGL01985:Vnn1 APN 10 23900744 missense probably benign 0.00
IGL02019:Vnn1 APN 10 23903551 missense possibly damaging 0.69
IGL02198:Vnn1 APN 10 23903425 missense probably benign 0.00
IGL02349:Vnn1 APN 10 23898503 missense possibly damaging 0.91
IGL02738:Vnn1 APN 10 23904622 missense probably benign 0.00
IGL03058:Vnn1 APN 10 23904544 missense probably benign 0.06
R0008:Vnn1 UTSW 10 23898602 critical splice donor site probably null
R0030:Vnn1 UTSW 10 23900846 missense probably benign 0.08
R0508:Vnn1 UTSW 10 23895012 missense probably benign 0.01
R0781:Vnn1 UTSW 10 23899601 missense possibly damaging 0.46
R1110:Vnn1 UTSW 10 23899601 missense possibly damaging 0.46
R1757:Vnn1 UTSW 10 23900828 missense possibly damaging 0.49
R1757:Vnn1 UTSW 10 23900829 missense probably benign 0.00
R1778:Vnn1 UTSW 10 23899517 missense possibly damaging 0.67
R2011:Vnn1 UTSW 10 23894971 nonsense probably null
R2055:Vnn1 UTSW 10 23900577 splice site probably benign
R2158:Vnn1 UTSW 10 23900755 nonsense probably null
R2186:Vnn1 UTSW 10 23897401 missense probably benign 0.29
R4277:Vnn1 UTSW 10 23898512 missense possibly damaging 0.89
R4279:Vnn1 UTSW 10 23898512 missense possibly damaging 0.89
R4473:Vnn1 UTSW 10 23894891 missense probably benign
R4590:Vnn1 UTSW 10 23899405 missense possibly damaging 0.61
R4708:Vnn1 UTSW 10 23897352 missense probably benign 0.01
R4794:Vnn1 UTSW 10 23900704 missense probably benign 0.01
R5266:Vnn1 UTSW 10 23903405 missense probably damaging 1.00
R5495:Vnn1 UTSW 10 23898564 missense probably damaging 0.98
R7081:Vnn1 UTSW 10 23895005 missense possibly damaging 0.66
R7088:Vnn1 UTSW 10 23900747 missense probably benign 0.00
R7221:Vnn1 UTSW 10 23895054 missense probably benign 0.07
R7334:Vnn1 UTSW 10 23900760 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- GCATTCCTGACCAGAGAACTAAG -3'
(R):5'- TAGGATACCTGCTTCGCTGC -3'

Sequencing Primer
(F):5'- CTGAAACTGTTGCTTTCAGGGAC -3'
(R):5'- TTCGCTGCAGATACGATCG -3'
Posted On2017-07-14