Incidental Mutation 'R6064:Catsper3'
ID483983
Institutional Source Beutler Lab
Gene Symbol Catsper3
Ensembl Gene ENSMUSG00000021499
Gene Namecation channel, sperm associated 3
Synonyms
MMRRC Submission 044228-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6064 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location55784568-55808998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55806252 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 278 (F278L)
Ref Sequence ENSEMBL: ENSMUSP00000021961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021961] [ENSMUST00000109898]
Predicted Effect probably damaging
Transcript: ENSMUST00000021961
AA Change: F278L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021961
Gene: ENSMUSG00000021499
AA Change: F278L

DomainStartEndE-ValueType
Pfam:Ion_trans 49 277 1.8e-33 PFAM
Pfam:PKD_channel 144 273 5e-7 PFAM
coiled coil region 283 311 N/A INTRINSIC
low complexity region 387 395 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109898
AA Change: F265L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105524
Gene: ENSMUSG00000021499
AA Change: F265L

DomainStartEndE-ValueType
Pfam:Ion_trans 72 254 4.9e-32 PFAM
Pfam:PKD_channel 125 261 2.1e-7 PFAM
coiled coil region 270 298 N/A INTRINSIC
low complexity region 374 382 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for this mutation are viable and exhibit no gross physical or behavioral abnormality. Although wild-type and homozygous mutant females bred to wild-type males exhibit similar fertility, male homozygotes are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 C T 5: 49,960,325 D1294N probably damaging Het
Atf1 A G 15: 100,252,148 T92A probably benign Het
Bach1 A G 16: 87,729,864 D738G probably damaging Het
Chsy3 GT G 18: 59,176,166 probably null Het
Cmya5 T A 13: 93,089,649 N2977I probably damaging Het
Cnbd1 T A 4: 18,895,084 E219D probably benign Het
Dst A G 1: 34,194,051 D3556G probably damaging Het
Duox1 A G 2: 122,320,762 E306G probably benign Het
Fstl5 T A 3: 76,322,298 F135L probably benign Het
Fyb A C 15: 6,638,868 K514T probably damaging Het
Gsap T A 5: 21,229,225 C280S possibly damaging Het
Lrig1 T C 6: 94,626,447 E240G probably damaging Het
Macc1 A T 12: 119,445,665 H56L probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Muc6 T C 7: 141,648,374 R696G probably damaging Het
Nup210 T C 6: 91,055,291 I32V probably benign Het
Olfr1155 A G 2: 87,943,484 M48T probably benign Het
Olfr183 T G 16: 58,999,823 I46S probably damaging Het
Olfr668 C T 7: 104,925,392 R124H probably benign Het
Ovch2 T C 7: 107,796,572 T80A probably damaging Het
Rad51ap2 T A 12: 11,457,417 Y447N possibly damaging Het
Rb1cc1 A G 1: 6,249,734 T1126A probably benign Het
Scgb1b10 T C 7: 32,101,202 L72S probably damaging Het
Slc25a33 A G 4: 149,752,464 V141A probably benign Het
Tbx21 T C 11: 97,114,911 Y76C probably damaging Het
Tmem235 T C 11: 117,862,938 V107A possibly damaging Het
Vnn1 G T 10: 23,894,909 A12S probably benign Het
Zfp606 T G 7: 12,481,033 W63G possibly damaging Het
Zfp788 T A 7: 41,648,454 F119L probably benign Het
Other mutations in Catsper3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Catsper3 APN 13 55798822 missense possibly damaging 0.94
IGL01794:Catsper3 APN 13 55798906 missense possibly damaging 0.84
IGL02419:Catsper3 APN 13 55808068 missense possibly damaging 0.94
IGL03108:Catsper3 APN 13 55808035 missense probably benign 0.01
R0241:Catsper3 UTSW 13 55804854 missense probably damaging 1.00
R0241:Catsper3 UTSW 13 55804854 missense probably damaging 1.00
R1870:Catsper3 UTSW 13 55805748 missense probably damaging 1.00
R2229:Catsper3 UTSW 13 55808054 missense probably damaging 1.00
R3055:Catsper3 UTSW 13 55808896 missense unknown
R3056:Catsper3 UTSW 13 55808896 missense unknown
R4092:Catsper3 UTSW 13 55784671 missense probably benign 0.00
R4113:Catsper3 UTSW 13 55786370 missense probably damaging 0.99
R5197:Catsper3 UTSW 13 55808176 critical splice donor site probably null
R6011:Catsper3 UTSW 13 55786492 missense probably damaging 0.96
R6385:Catsper3 UTSW 13 55786426 missense probably damaging 0.99
R6966:Catsper3 UTSW 13 55798859 missense probably damaging 0.98
R7128:Catsper3 UTSW 13 55798849 missense probably benign 0.00
R7373:Catsper3 UTSW 13 55808132 missense possibly damaging 0.87
R7565:Catsper3 UTSW 13 55784725 missense probably benign 0.10
Z1088:Catsper3 UTSW 13 55808104 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTACCCAACCCTGCAAGTTC -3'
(R):5'- TGGAATCCAAAGCCCTTCCTC -3'

Sequencing Primer
(F):5'- TCACCTTATGATGGAGGGCAGC -3'
(R):5'- AAAGCCCTTCCTCCTGGG -3'
Posted On2017-07-14