Incidental Mutation 'R6064:Fyb'
ID483985
Institutional Source Beutler Lab
Gene Symbol Fyb
Ensembl Gene ENSMUSG00000022148
Gene NameFYN binding protein
SynonymsB630013F22Rik, ADAP, FYB-120/130
MMRRC Submission 044228-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6064 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location6522853-6663313 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 6638868 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 514 (K514T)
Ref Sequence ENSEMBL: ENSMUSP00000087947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090461] [ENSMUST00000160612]
Predicted Effect probably damaging
Transcript: ENSMUST00000090461
AA Change: K514T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087947
Gene: ENSMUSG00000022148
AA Change: K514T

DomainStartEndE-ValueType
low complexity region 67 85 N/A INTRINSIC
low complexity region 149 160 N/A INTRINSIC
low complexity region 236 246 N/A INTRINSIC
low complexity region 335 353 N/A INTRINSIC
low complexity region 371 409 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
low complexity region 457 494 N/A INTRINSIC
SH3 502 559 1.24e-3 SMART
low complexity region 611 626 N/A INTRINSIC
Pfam:hSH3 731 819 2.9e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160612
SMART Domains Protein: ENSMUSP00000124553
Gene: ENSMUSG00000022148

DomainStartEndE-ValueType
low complexity region 27 65 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160698
Predicted Effect probably benign
Transcript: ENSMUST00000163073
SMART Domains Protein: ENSMUSP00000123895
Gene: ENSMUSG00000022148

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
Pfam:hSH3 86 170 4.1e-42 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is an adapter molecule that affects T cell receptor signaling and contains multiple protein-protein interaction domains. It is thought to couple T cell receptor stimulation with activation of integrin function. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased T cell proliferation, thymocytes and platelet counts and decreased TCR-stimulated leukocyte adhesion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 C T 5: 49,960,325 D1294N probably damaging Het
Atf1 A G 15: 100,252,148 T92A probably benign Het
Bach1 A G 16: 87,729,864 D738G probably damaging Het
Catsper3 T C 13: 55,806,252 F278L probably damaging Het
Chsy3 GT G 18: 59,176,166 probably null Het
Cmya5 T A 13: 93,089,649 N2977I probably damaging Het
Cnbd1 T A 4: 18,895,084 E219D probably benign Het
Dst A G 1: 34,194,051 D3556G probably damaging Het
Duox1 A G 2: 122,320,762 E306G probably benign Het
Fstl5 T A 3: 76,322,298 F135L probably benign Het
Gsap T A 5: 21,229,225 C280S possibly damaging Het
Lrig1 T C 6: 94,626,447 E240G probably damaging Het
Macc1 A T 12: 119,445,665 H56L probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Muc6 T C 7: 141,648,374 R696G probably damaging Het
Nup210 T C 6: 91,055,291 I32V probably benign Het
Olfr1155 A G 2: 87,943,484 M48T probably benign Het
Olfr183 T G 16: 58,999,823 I46S probably damaging Het
Olfr668 C T 7: 104,925,392 R124H probably benign Het
Ovch2 T C 7: 107,796,572 T80A probably damaging Het
Rad51ap2 T A 12: 11,457,417 Y447N possibly damaging Het
Rb1cc1 A G 1: 6,249,734 T1126A probably benign Het
Scgb1b10 T C 7: 32,101,202 L72S probably damaging Het
Slc25a33 A G 4: 149,752,464 V141A probably benign Het
Tbx21 T C 11: 97,114,911 Y76C probably damaging Het
Tmem235 T C 11: 117,862,938 V107A possibly damaging Het
Vnn1 G T 10: 23,894,909 A12S probably benign Het
Zfp606 T G 7: 12,481,033 W63G possibly damaging Het
Zfp788 T A 7: 41,648,454 F119L probably benign Het
Other mutations in Fyb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Fyb APN 15 6580777 missense probably damaging 0.99
IGL00801:Fyb APN 15 6644824 missense possibly damaging 0.86
IGL00974:Fyb APN 15 6642585 unclassified probably benign
IGL01377:Fyb APN 15 6580320 missense probably benign 0.01
IGL01982:Fyb APN 15 6580177 missense probably null 0.99
IGL02173:Fyb APN 15 6580695 missense probably benign 0.00
IGL02177:Fyb APN 15 6658566 critical splice donor site probably null
IGL02345:Fyb APN 15 6619662 missense possibly damaging 0.94
IGL02695:Fyb APN 15 6580921 missense probably damaging 1.00
IGL02820:Fyb APN 15 6658559 missense possibly damaging 0.65
IGL02867:Fyb APN 15 6580046 missense probably damaging 1.00
luegner UTSW 15 6580869 nonsense probably null
uebeltaeter UTSW 15 6638907 missense probably damaging 1.00
P0023:Fyb UTSW 15 6651854 missense probably damaging 1.00
R0028:Fyb UTSW 15 6644914 intron probably benign
R0364:Fyb UTSW 15 6580791 missense probably damaging 1.00
R0507:Fyb UTSW 15 6634816 missense probably benign 0.39
R0588:Fyb UTSW 15 6580459 missense probably benign 0.03
R0742:Fyb UTSW 15 6634816 missense probably benign 0.39
R0930:Fyb UTSW 15 6638828 missense probably damaging 1.00
R1184:Fyb UTSW 15 6638900 missense probably damaging 1.00
R1446:Fyb UTSW 15 6652466 missense probably benign 0.02
R1481:Fyb UTSW 15 6619647 missense probably benign 0.01
R1711:Fyb UTSW 15 6580479 missense probably damaging 1.00
R2041:Fyb UTSW 15 6644787 missense possibly damaging 0.78
R2176:Fyb UTSW 15 6579954 missense probably damaging 1.00
R2224:Fyb UTSW 15 6652383 missense probably damaging 1.00
R2372:Fyb UTSW 15 6651907 splice site probably benign
R3236:Fyb UTSW 15 6630116 missense probably damaging 0.96
R4117:Fyb UTSW 15 6630116 missense probably damaging 0.96
R4181:Fyb UTSW 15 6580923 missense probably benign 0.00
R4322:Fyb UTSW 15 6580819 missense possibly damaging 0.84
R4952:Fyb UTSW 15 6638811 missense probably damaging 1.00
R4981:Fyb UTSW 15 6646611 splice site probably benign
R5055:Fyb UTSW 15 6585149 unclassified probably benign
R5368:Fyb UTSW 15 6580678 unclassified probably null
R5719:Fyb UTSW 15 6580869 nonsense probably null
R5822:Fyb UTSW 15 6663226 unclassified probably benign
R6929:Fyb UTSW 15 6638907 missense probably damaging 1.00
R7125:Fyb UTSW 15 6644856 missense possibly damaging 0.77
R7243:Fyb UTSW 15 6643699 missense probably benign 0.19
R7748:Fyb UTSW 15 6638826 missense probably damaging 1.00
R7750:Fyb UTSW 15 6660703 missense probably damaging 1.00
R7902:Fyb UTSW 15 6660716 critical splice donor site probably null
R8182:Fyb UTSW 15 6651812 missense probably benign
Z1088:Fyb UTSW 15 6658540 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- ACACTGTGTCTGCCTTAACCC -3'
(R):5'- TTTGAATCGGGGAAGAGCTGG -3'

Sequencing Primer
(F):5'- GTCTGCCTTAACCCCTTTAATAAGAG -3'
(R):5'- GGAAGGTGACTATGATCAAAACATG -3'
Posted On2017-07-14