Incidental Mutation 'R6064:Olfr183'
ID483987
Institutional Source Beutler Lab
Gene Symbol Olfr183
Ensembl Gene ENSMUSG00000062105
Gene Nameolfactory receptor 183
SynonymsMOR183-2, GA_x54KRFPKG5P-55229158-55230087
MMRRC Submission 044228-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6064 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location58995357-59001441 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 58999823 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 46 (I46S)
Ref Sequence ENSEMBL: ENSMUSP00000149279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073320] [ENSMUST00000206303] [ENSMUST00000213465] [ENSMUST00000214831] [ENSMUST00000214916]
Predicted Effect probably damaging
Transcript: ENSMUST00000073320
AA Change: I46S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080602
Gene: ENSMUSG00000062105
AA Change: I46S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 5.7e-48 PFAM
Pfam:7tm_1 41 290 4.4e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206303
AA Change: I46S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000213465
AA Change: I46S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000214831
AA Change: I46S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000214916
AA Change: I46S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra3 C T 5: 49,960,325 D1294N probably damaging Het
Atf1 A G 15: 100,252,148 T92A probably benign Het
Bach1 A G 16: 87,729,864 D738G probably damaging Het
Catsper3 T C 13: 55,806,252 F278L probably damaging Het
Chsy3 GT G 18: 59,176,166 probably null Het
Cmya5 T A 13: 93,089,649 N2977I probably damaging Het
Cnbd1 T A 4: 18,895,084 E219D probably benign Het
Dst A G 1: 34,194,051 D3556G probably damaging Het
Duox1 A G 2: 122,320,762 E306G probably benign Het
Fstl5 T A 3: 76,322,298 F135L probably benign Het
Fyb A C 15: 6,638,868 K514T probably damaging Het
Gsap T A 5: 21,229,225 C280S possibly damaging Het
Lrig1 T C 6: 94,626,447 E240G probably damaging Het
Macc1 A T 12: 119,445,665 H56L probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Muc6 T C 7: 141,648,374 R696G probably damaging Het
Nup210 T C 6: 91,055,291 I32V probably benign Het
Olfr1155 A G 2: 87,943,484 M48T probably benign Het
Olfr668 C T 7: 104,925,392 R124H probably benign Het
Ovch2 T C 7: 107,796,572 T80A probably damaging Het
Rad51ap2 T A 12: 11,457,417 Y447N possibly damaging Het
Rb1cc1 A G 1: 6,249,734 T1126A probably benign Het
Scgb1b10 T C 7: 32,101,202 L72S probably damaging Het
Slc25a33 A G 4: 149,752,464 V141A probably benign Het
Tbx21 T C 11: 97,114,911 Y76C probably damaging Het
Tmem235 T C 11: 117,862,938 V107A possibly damaging Het
Vnn1 G T 10: 23,894,909 A12S probably benign Het
Zfp606 T G 7: 12,481,033 W63G possibly damaging Het
Zfp788 T A 7: 41,648,454 F119L probably benign Het
Other mutations in Olfr183
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02294:Olfr183 APN 16 59000065 missense probably damaging 1.00
IGL02795:Olfr183 APN 16 59000277 missense possibly damaging 0.73
IGL02803:Olfr183 APN 16 58999958 missense probably benign 0.33
IGL02837:Olfr183 UTSW 16 59000546 missense probably damaging 1.00
R0045:Olfr183 UTSW 16 59000491 missense probably benign 0.00
R0372:Olfr183 UTSW 16 59000087 missense probably benign 0.03
R0652:Olfr183 UTSW 16 58999700 missense probably damaging 0.99
R0890:Olfr183 UTSW 16 58999787 missense possibly damaging 0.94
R1279:Olfr183 UTSW 16 59000138 missense possibly damaging 0.94
R1429:Olfr183 UTSW 16 59000138 missense possibly damaging 0.94
R1473:Olfr183 UTSW 16 58999912 missense probably benign 0.32
R2115:Olfr183 UTSW 16 59000420 missense possibly damaging 0.50
R2117:Olfr183 UTSW 16 59000420 missense possibly damaging 0.50
R4508:Olfr183 UTSW 16 58999775 missense probably benign 0.26
R4709:Olfr183 UTSW 16 59000095 missense probably benign 0.01
R4929:Olfr183 UTSW 16 59000219 missense probably damaging 1.00
R5478:Olfr183 UTSW 16 59000062 missense possibly damaging 0.88
R5522:Olfr183 UTSW 16 58999905 missense probably benign 0.22
R5571:Olfr183 UTSW 16 59000206 missense probably benign 0.02
R5685:Olfr183 UTSW 16 59000346 missense probably benign
R7443:Olfr183 UTSW 16 58999990 missense probably damaging 0.96
R7870:Olfr183 UTSW 16 58999723 missense probably benign 0.00
R8085:Olfr183 UTSW 16 59000069 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACGTAACTCCTTCCCAGTGACTAC -3'
(R):5'- GTGGTCACACTGATTGCAAAG -3'

Sequencing Primer
(F):5'- TTCCCAGTGACTACTTATCTGAC -3'
(R):5'- ATAGCATCCTCGGTGTCA -3'
Posted On2017-07-14