Incidental Mutation 'R6065:Ngef'
ID483991
Institutional Source Beutler Lab
Gene Symbol Ngef
Ensembl Gene ENSMUSG00000026259
Gene Nameneuronal guanine nucleotide exchange factor
SynonymsTims2, ephexin
MMRRC Submission 044229-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6065 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location87476834-87573870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87477648 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 680 (N680I)
Ref Sequence ENSEMBL: ENSMUSP00000066894 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027476] [ENSMUST00000027477] [ENSMUST00000068681]
Predicted Effect probably benign
Transcript: ENSMUST00000027476
SMART Domains Protein: ENSMUSP00000027476
Gene: ENSMUSG00000026258

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DUF4690 26 121 7.6e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000027477
AA Change: N590I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027477
Gene: ENSMUSG00000026259
AA Change: N590I

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
low complexity region 15 28 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
RhoGEF 187 366 8.16e-46 SMART
PH 400 513 1.2e-7 SMART
SH3 525 582 8.43e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000068681
AA Change: N680I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066894
Gene: ENSMUSG00000026259
AA Change: N680I

DomainStartEndE-ValueType
low complexity region 213 226 N/A INTRINSIC
RhoGEF 277 456 8.16e-46 SMART
PH 490 603 1.2e-7 SMART
SH3 615 672 8.43e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166463
Predicted Effect probably benign
Transcript: ENSMUST00000168235
SMART Domains Protein: ENSMUSP00000127674
Gene: ENSMUSG00000026259

DomainStartEndE-ValueType
Blast:RhoGEF 2 40 1e-16 BLAST
PH 74 187 1.2e-7 SMART
Blast:SH3 199 232 1e-15 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191095
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and show no overt axonal phenotype; however, cultured retinal ganglion cells display defects in axonal outgrowth and ephrin-induced growth cone collapse. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff1 T C 5: 103,842,252 S871P probably damaging Het
BC055324 A T 1: 163,959,388 L704Q probably benign Het
BC055324 A G 1: 163,987,688 M88T probably damaging Het
Ccdc150 T C 1: 54,263,599 I126T possibly damaging Het
Ccdc87 A T 19: 4,841,240 M587L probably benign Het
Cd300ld2 G A 11: 115,012,602 probably benign Het
Chsy3 GT G 18: 59,176,166 probably null Het
Dchs1 T C 7: 105,755,421 D2638G probably damaging Het
Dnah5 A T 15: 28,230,468 I171F possibly damaging Het
Dnah9 T C 11: 65,855,338 D3983G probably benign Het
Dnah9 A G 11: 66,145,397 S396P possibly damaging Het
Fbxw15 T A 9: 109,568,178 D18V probably damaging Het
Fcnb A C 2: 28,079,910 C106G probably damaging Het
Gm3453 T C 14: 5,978,233 T57A probably damaging Het
Grin2a T C 16: 9,761,907 D164G possibly damaging Het
Hmcn1 C T 1: 150,770,330 V706I probably benign Het
Kcnj12 C T 11: 61,069,877 L334F probably damaging Het
Lama3 T C 18: 12,469,928 Y1057H possibly damaging Het
Mycbpap T C 11: 94,508,187 probably null Het
Myo18b A G 5: 112,692,781 L2382P probably benign Het
Nop2 A G 6: 125,144,565 H770R probably benign Het
Pcdhgc3 A G 18: 37,807,676 T377A possibly damaging Het
Prl7b1 T C 13: 27,604,546 K109E probably benign Het
Ptprk C T 10: 28,475,170 T553I probably damaging Het
Rab3d T C 9: 21,910,519 T209A probably benign Het
Ralgapa1 A G 12: 55,757,924 probably null Het
Rspry1 T C 8: 94,622,987 M1T probably null Het
Sec13 G T 6: 113,730,832 P176T probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc4a7 C A 14: 14,739,836 T236K probably benign Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Syt2 A G 1: 134,747,557 N382S probably benign Het
Tm7sf2 A G 19: 6,063,386 M345T possibly damaging Het
Ubr4 T G 4: 139,421,238 C1678G probably damaging Het
Urb1 A G 16: 90,803,332 S188P probably benign Het
Vmn2r82 A G 10: 79,385,376 S524G probably damaging Het
Wdr19 A G 5: 65,221,713 N233S probably benign Het
Other mutations in Ngef
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02221:Ngef APN 1 87540696 missense probably benign 0.06
IGL02475:Ngef APN 1 87479150 missense possibly damaging 0.79
IGL02478:Ngef APN 1 87480579 splice site probably benign
IGL03002:Ngef APN 1 87509392 splice site probably null
H8562:Ngef UTSW 1 87487807 missense possibly damaging 0.84
R0078:Ngef UTSW 1 87540665 missense probably benign 0.12
R0145:Ngef UTSW 1 87540648 intron probably benign
R0193:Ngef UTSW 1 87509334 missense probably benign 0.03
R0244:Ngef UTSW 1 87487962 unclassified probably benign
R0486:Ngef UTSW 1 87479126 missense probably damaging 1.00
R0865:Ngef UTSW 1 87484601 missense probably benign
R1824:Ngef UTSW 1 87503264 critical splice donor site probably null
R1994:Ngef UTSW 1 87487904 missense probably damaging 1.00
R2020:Ngef UTSW 1 87545968 missense probably benign 0.43
R4059:Ngef UTSW 1 87486231 missense probably damaging 0.99
R4770:Ngef UTSW 1 87477561 missense probably damaging 1.00
R4959:Ngef UTSW 1 87503348 missense possibly damaging 0.68
R5197:Ngef UTSW 1 87509368 nonsense probably null
R5286:Ngef UTSW 1 87545830 missense probably benign
R5293:Ngef UTSW 1 87503429 small deletion probably benign
R6192:Ngef UTSW 1 87487900 missense probably damaging 0.98
R6925:Ngef UTSW 1 87503263 splice site probably null
R7176:Ngef UTSW 1 87480695 missense possibly damaging 0.94
R7437:Ngef UTSW 1 87480605 missense probably damaging 0.98
R7760:Ngef UTSW 1 87540773 missense probably benign 0.00
R8058:Ngef UTSW 1 87546022 nonsense probably null
Z1177:Ngef UTSW 1 87482709 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CCTAAGGCCCTCTGAATCTGTC -3'
(R):5'- TGAACTCCTGAGGATGCTCAATC -3'

Posted On2017-07-14