Incidental Mutation 'R6065:Syt2'
ID483992
Institutional Source Beutler Lab
Gene Symbol Syt2
Ensembl Gene ENSMUSG00000026452
Gene Namesynaptotagmin II
Synonyms
MMRRC Submission 044229-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R6065 (G1)
Quality Score161.009
Status Not validated
Chromosome1
Chromosomal Location134646677-134762593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134747557 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 382 (N382S)
Ref Sequence ENSEMBL: ENSMUSP00000140081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121990] [ENSMUST00000188842]
Predicted Effect probably benign
Transcript: ENSMUST00000121990
AA Change: N382S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000112438
Gene: ENSMUSG00000026452
AA Change: N382S

DomainStartEndE-ValueType
PDB:4KBB|D 5 63 7e-16 PDB
transmembrane domain 65 87 N/A INTRINSIC
low complexity region 124 145 N/A INTRINSIC
C2 158 260 7.21e-22 SMART
C2 289 403 1.86e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187702
Predicted Effect probably benign
Transcript: ENSMUST00000188842
AA Change: N382S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000140081
Gene: ENSMUSG00000026452
AA Change: N382S

DomainStartEndE-ValueType
PDB:4KBB|D 5 63 7e-16 PDB
transmembrane domain 65 87 N/A INTRINSIC
low complexity region 124 145 N/A INTRINSIC
C2 158 260 7.21e-22 SMART
C2 289 403 1.86e-24 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a synaptic vesicle membrane protein. The encoded protein is thought to function as a calcium sensor in vesicular trafficking and exocytosis. Mutations in this gene are associated with myasthenic syndrome, presynaptic, congenital, with or without motor neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele are viable but sterile, weigh less and show ataxia and altered spontaneous and Ca2+-evoked neurotransmitter release. Mice homozygous for a null allele die at weaning showing growth arrest, motor dysfunction and impaired Ca2+-evoked neurotransmitter release. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff1 T C 5: 103,842,252 S871P probably damaging Het
BC055324 A T 1: 163,959,388 L704Q probably benign Het
BC055324 A G 1: 163,987,688 M88T probably damaging Het
Ccdc150 T C 1: 54,263,599 I126T possibly damaging Het
Ccdc87 A T 19: 4,841,240 M587L probably benign Het
Cd300ld2 G A 11: 115,012,602 probably benign Het
Chsy3 GT G 18: 59,176,166 probably null Het
Dchs1 T C 7: 105,755,421 D2638G probably damaging Het
Dnah5 A T 15: 28,230,468 I171F possibly damaging Het
Dnah9 T C 11: 65,855,338 D3983G probably benign Het
Dnah9 A G 11: 66,145,397 S396P possibly damaging Het
Fbxw15 T A 9: 109,568,178 D18V probably damaging Het
Fcnb A C 2: 28,079,910 C106G probably damaging Het
Gm3453 T C 14: 5,978,233 T57A probably damaging Het
Grin2a T C 16: 9,761,907 D164G possibly damaging Het
Hmcn1 C T 1: 150,770,330 V706I probably benign Het
Kcnj12 C T 11: 61,069,877 L334F probably damaging Het
Lama3 T C 18: 12,469,928 Y1057H possibly damaging Het
Mycbpap T C 11: 94,508,187 probably null Het
Myo18b A G 5: 112,692,781 L2382P probably benign Het
Ngef T A 1: 87,477,648 N680I probably damaging Het
Nop2 A G 6: 125,144,565 H770R probably benign Het
Pcdhgc3 A G 18: 37,807,676 T377A possibly damaging Het
Prl7b1 T C 13: 27,604,546 K109E probably benign Het
Ptprk C T 10: 28,475,170 T553I probably damaging Het
Rab3d T C 9: 21,910,519 T209A probably benign Het
Ralgapa1 A G 12: 55,757,924 probably null Het
Rspry1 T C 8: 94,622,987 M1T probably null Het
Sec13 G T 6: 113,730,832 P176T probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc4a7 C A 14: 14,739,836 T236K probably benign Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Tm7sf2 A G 19: 6,063,386 M345T possibly damaging Het
Ubr4 T G 4: 139,421,238 C1678G probably damaging Het
Urb1 A G 16: 90,803,332 S188P probably benign Het
Vmn2r82 A G 10: 79,385,376 S524G probably damaging Het
Wdr19 A G 5: 65,221,713 N233S probably benign Het
Other mutations in Syt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02385:Syt2 APN 1 134745815 missense probably benign 0.07
IGL02476:Syt2 APN 1 134747631 missense probably benign 0.01
IGL02487:Syt2 APN 1 134740865 missense probably damaging 0.99
IGL02524:Syt2 APN 1 134741965 missense probably benign
IGL02611:Syt2 APN 1 134741882 missense possibly damaging 0.90
IGL03173:Syt2 APN 1 134743579 missense possibly damaging 0.81
IGL03303:Syt2 APN 1 134741911 missense probably benign 0.44
kringle UTSW 1 134747620 missense probably damaging 1.00
R1661:Syt2 UTSW 1 134747620 missense probably damaging 1.00
R1665:Syt2 UTSW 1 134747620 missense probably damaging 1.00
R2049:Syt2 UTSW 1 134746741 splice site probably benign
R2130:Syt2 UTSW 1 134746741 splice site probably benign
R2141:Syt2 UTSW 1 134746741 splice site probably benign
R3154:Syt2 UTSW 1 134741861 missense possibly damaging 0.95
R5392:Syt2 UTSW 1 134744021 missense probably damaging 1.00
R5431:Syt2 UTSW 1 134740957 missense probably benign 0.03
R6381:Syt2 UTSW 1 134746850 missense probably damaging 1.00
R6816:Syt2 UTSW 1 134745800 missense probably damaging 1.00
R6923:Syt2 UTSW 1 134746763 missense possibly damaging 0.76
R7002:Syt2 UTSW 1 134744104 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTAGTGCACAGTGGCAG -3'
(R):5'- AGGTCGCGTAACTGAGGTATTG -3'

Posted On2017-07-14