Incidental Mutation 'R6065:BC055324'
ID483995
Institutional Source Beutler Lab
Gene Symbol BC055324
Ensembl Gene ENSMUSG00000041406
Gene NamecDNA sequence BC055324
Synonyms
MMRRC Submission 044229-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6065 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location163945993-163994796 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 163987688 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 88 (M88T)
Ref Sequence ENSEMBL: ENSMUSP00000095101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045876] [ENSMUST00000097493] [ENSMUST00000160926]
Predicted Effect probably damaging
Transcript: ENSMUST00000045876
AA Change: M88T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000043143
Gene: ENSMUSG00000041406
AA Change: M88T

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DUF4487 233 779 2.3e-209 PFAM
low complexity region 877 889 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097493
AA Change: M88T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000095101
Gene: ENSMUSG00000041406
AA Change: M88T

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Pfam:DUF4487 233 779 1.3e-186 PFAM
low complexity region 877 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160926
SMART Domains Protein: ENSMUSP00000124826
Gene: ENSMUSG00000041406

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162949
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff1 T C 5: 103,842,252 S871P probably damaging Het
Ccdc150 T C 1: 54,263,599 I126T possibly damaging Het
Ccdc87 A T 19: 4,841,240 M587L probably benign Het
Cd300ld2 G A 11: 115,012,602 probably benign Het
Chsy3 GT G 18: 59,176,166 probably null Het
Dchs1 T C 7: 105,755,421 D2638G probably damaging Het
Dnah5 A T 15: 28,230,468 I171F possibly damaging Het
Dnah9 T C 11: 65,855,338 D3983G probably benign Het
Dnah9 A G 11: 66,145,397 S396P possibly damaging Het
Fbxw15 T A 9: 109,568,178 D18V probably damaging Het
Fcnb A C 2: 28,079,910 C106G probably damaging Het
Gm3453 T C 14: 5,978,233 T57A probably damaging Het
Grin2a T C 16: 9,761,907 D164G possibly damaging Het
Hmcn1 C T 1: 150,770,330 V706I probably benign Het
Kcnj12 C T 11: 61,069,877 L334F probably damaging Het
Lama3 T C 18: 12,469,928 Y1057H possibly damaging Het
Mycbpap T C 11: 94,508,187 probably null Het
Myo18b A G 5: 112,692,781 L2382P probably benign Het
Ngef T A 1: 87,477,648 N680I probably damaging Het
Nop2 A G 6: 125,144,565 H770R probably benign Het
Pcdhgc3 A G 18: 37,807,676 T377A possibly damaging Het
Prl7b1 T C 13: 27,604,546 K109E probably benign Het
Ptprk C T 10: 28,475,170 T553I probably damaging Het
Rab3d T C 9: 21,910,519 T209A probably benign Het
Ralgapa1 A G 12: 55,757,924 probably null Het
Rspry1 T C 8: 94,622,987 M1T probably null Het
Sec13 G T 6: 113,730,832 P176T probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc4a7 C A 14: 14,739,836 T236K probably benign Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Syt2 A G 1: 134,747,557 N382S probably benign Het
Tm7sf2 A G 19: 6,063,386 M345T possibly damaging Het
Ubr4 T G 4: 139,421,238 C1678G probably damaging Het
Urb1 A G 16: 90,803,332 S188P probably benign Het
Vmn2r82 A G 10: 79,385,376 S524G probably damaging Het
Wdr19 A G 5: 65,221,713 N233S probably benign Het
Other mutations in BC055324
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02051:BC055324 APN 1 163957522 missense probably benign 0.01
IGL02638:BC055324 APN 1 163959299 nonsense probably null
IGL03337:BC055324 APN 1 163990759 missense probably damaging 0.96
IGL03048:BC055324 UTSW 1 163964525 missense probably benign 0.04
R0106:BC055324 UTSW 1 163982811 unclassified probably benign
R0106:BC055324 UTSW 1 163982811 unclassified probably benign
R0414:BC055324 UTSW 1 163968321 missense probably benign 0.02
R0511:BC055324 UTSW 1 163971843 splice site probably null
R1323:BC055324 UTSW 1 163955461 unclassified probably benign
R1870:BC055324 UTSW 1 163964794 missense probably damaging 1.00
R2129:BC055324 UTSW 1 163966457 missense probably damaging 1.00
R3716:BC055324 UTSW 1 163956888 missense probably damaging 1.00
R3783:BC055324 UTSW 1 163987683 missense probably benign 0.27
R3872:BC055324 UTSW 1 163986964 missense probably damaging 0.99
R4427:BC055324 UTSW 1 163954284 missense probably benign
R5069:BC055324 UTSW 1 163987674 missense possibly damaging 0.59
R5620:BC055324 UTSW 1 163962044 nonsense probably null
R5681:BC055324 UTSW 1 163962085 missense probably damaging 1.00
R5699:BC055324 UTSW 1 163957551 missense probably benign 0.26
R5936:BC055324 UTSW 1 163987012 missense probably benign 0.00
R6065:BC055324 UTSW 1 163959388 missense probably benign 0.08
R6075:BC055324 UTSW 1 163978087 missense probably damaging 1.00
R6466:BC055324 UTSW 1 163954165 missense probably benign 0.01
R6701:BC055324 UTSW 1 163971843 splice site probably null
R6776:BC055324 UTSW 1 163976749 missense probably damaging 1.00
R6851:BC055324 UTSW 1 163964767 missense probably damaging 1.00
R6923:BC055324 UTSW 1 163986885 critical splice donor site probably null
R7125:BC055324 UTSW 1 163962062 missense probably benign 0.00
R7361:BC055324 UTSW 1 163986033 missense possibly damaging 0.54
R7492:BC055324 UTSW 1 163959328 missense probably benign 0.35
Z1177:BC055324 UTSW 1 163964517 missense not run
Predicted Primers PCR Primer
(F):5'- ATGCATGCATGAGGTACCACC -3'
(R):5'- CTTGTATGGCTGAGAAGCACTTAAAG -3'

Posted On2017-07-14