Mutagenetix > Incidental Mutations

Incidental Mutation 'R6065:Wdr19'

483999

Institutional Source

Beutler Lab

Gene Symbol

Wdr19

Ensembl Gene

ENSMUSG00000037890

Gene Name

WD repeat domain 19

Synonyms

MMRRC Submission

044229-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6065 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

65199696-65260415 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 65221713 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 233 (N233S)

Ref Sequence

ENSEMBL: ENSMUSP00000144866 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041892] [ENSMUST00000203653]

Predicted Effect

probably benign
Transcript: ENSMUST00000041892
AA Change: N233S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000038098
Gene: ENSMUSG00000037890
AA Change: N233S

Domain	Start	End	E-Value	Type
WD40	6	42	4.26e1	SMART
WD40	44	83	2.13e1	SMART
WD40	85	125	2.75e1	SMART
WD40	128	166	2.67e-1	SMART
Blast:WD40	220	258	6e-9	BLAST
WD40	264	302	1.46e-1	SMART
Blast:WD40	308	347	2e-18	BLAST
Pfam:WD40_3	508	564	2.7e-32	PFAM
low complexity region	1103	1116	N/A	INTRINSIC
low complexity region	1259	1268	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203359

Predicted Effect

probably benign
Transcript: ENSMUST00000203653
AA Change: N233S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000144866
Gene: ENSMUSG00000037890
AA Change: N233S

Domain	Start	End	E-Value	Type
WD40	6	42	4.26e1	SMART
WD40	44	83	2.13e1	SMART
WD40	85	125	2.75e1	SMART
WD40	128	166	2.67e-1	SMART
Blast:WD40	220	258	6e-9	BLAST
WD40	264	302	1.46e-1	SMART
Blast:WD40	308	347	2e-18	BLAST
Pfam:WD40_3	508	564	2.7e-32	PFAM
low complexity region	1103	1116	N/A	INTRINSIC
low complexity region	1259	1268	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203676

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204375

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204647

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WD (tryptophan-aspartic acid) repeat family, which is a large family of structurally-related proteins known to participate in a wide range of cellular processes. Each WD repeat typically contains about 40 amino acids that are usually bracketed by glycine-histidine and tryptophan-aspartic acid (WD) dipeptides. This protein contains six WD repeats, three transmembrane domains, and a clathrin heavy-chain repeat. Mutations in this gene have been described in individuals with a wide range of disorders affecting function of the cilium. These disorders are known as ciliopathies, and include Jeune syndrome, Sensenbrenner syndromes, Senior-Loken syndrome, combined or isolated nephronophthisis (NPHP), and retinitis pigmentosa (RP). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E10. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aff1	T	C	5: 103,842,252	S871P	probably damaging	Het
BC055324	A	T	1: 163,959,388	L704Q	probably benign	Het
BC055324	A	G	1: 163,987,688	M88T	probably damaging	Het
Ccdc150	T	C	1: 54,263,599	I126T	possibly damaging	Het
Ccdc87	A	T	19: 4,841,240	M587L	probably benign	Het
Cd300ld2	G	A	11: 115,012,602		probably benign	Het
Chsy3	GT	G	18: 59,176,166		probably null	Het
Dchs1	T	C	7: 105,755,421	D2638G	probably damaging	Het
Dnah5	A	T	15: 28,230,468	I171F	possibly damaging	Het
Dnah9	T	C	11: 65,855,338	D3983G	probably benign	Het
Dnah9	A	G	11: 66,145,397	S396P	possibly damaging	Het
Fbxw15	T	A	9: 109,568,178	D18V	probably damaging	Het
Fcnb	A	C	2: 28,079,910	C106G	probably damaging	Het
Gm3453	T	C	14: 5,978,233	T57A	probably damaging	Het
Grin2a	T	C	16: 9,761,907	D164G	possibly damaging	Het
Hmcn1	C	T	1: 150,770,330	V706I	probably benign	Het
Kcnj12	C	T	11: 61,069,877	L334F	probably damaging	Het
Lama3	T	C	18: 12,469,928	Y1057H	possibly damaging	Het
Mycbpap	T	C	11: 94,508,187		probably null	Het
Myo18b	A	G	5: 112,692,781	L2382P	probably benign	Het
Ngef	T	A	1: 87,477,648	N680I	probably damaging	Het
Nop2	A	G	6: 125,144,565	H770R	probably benign	Het
Pcdhgc3	A	G	18: 37,807,676	T377A	possibly damaging	Het
Prl7b1	T	C	13: 27,604,546	K109E	probably benign	Het
Ptprk	C	T	10: 28,475,170	T553I	probably damaging	Het
Rab3d	T	C	9: 21,910,519	T209A	probably benign	Het
Ralgapa1	A	G	12: 55,757,924		probably null	Het
Rspry1	T	C	8: 94,622,987	M1T	probably null	Het
Sec13	G	T	6: 113,730,832	P176T	probably benign	Het
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Slc4a7	C	A	14: 14,739,836	T236K	probably benign	Het
Svil	T	G	18: 5,106,724	V1855G	probably damaging	Het
Syt2	A	G	1: 134,747,557	N382S	probably benign	Het
Tm7sf2	A	G	19: 6,063,386	M345T	possibly damaging	Het
Ubr4	T	G	4: 139,421,238	C1678G	probably damaging	Het
Urb1	A	G	16: 90,803,332	S188P	probably benign	Het
Vmn2r82	A	G	10: 79,385,376	S524G	probably damaging	Het

Other mutations in Wdr19

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00985:Wdr19	APN	5	65252299	missense	probably benign	0.41
IGL01346:Wdr19	APN	5	65221739	splice site	probably benign
IGL01761:Wdr19	APN	5	65215820	missense	possibly damaging	0.60
IGL01845:Wdr19	APN	5	65225366	missense	probably damaging	0.98
IGL01977:Wdr19	APN	5	65228569	missense	probably benign
IGL02314:Wdr19	APN	5	65257120	missense	probably benign	0.26
IGL02455:Wdr19	APN	5	65224759	missense	probably benign	0.01
IGL02542:Wdr19	APN	5	65231071	missense	probably benign
IGL02616:Wdr19	APN	5	65223581	missense	probably damaging	0.97
IGL02661:Wdr19	APN	5	65245808	missense	probably benign	0.06
IGL02927:Wdr19	APN	5	65252378	missense	possibly damaging	0.80
IGL02958:Wdr19	APN	5	65212807	splice site	probably null
IGL03083:Wdr19	APN	5	65230976	missense	probably benign	0.01
IGL03332:Wdr19	APN	5	65227143	missense	possibly damaging	0.89
detritus	UTSW	5	65212891	missense	possibly damaging	0.59
refuse	UTSW	5	65228292	missense	possibly damaging	0.64
R0924:Wdr19	UTSW	5	65256439	splice site	probably benign
R1178:Wdr19	UTSW	5	65223865	missense	probably damaging	0.98
R1229:Wdr19	UTSW	5	65256391	missense	possibly damaging	0.94
R1434:Wdr19	UTSW	5	65223504	splice site	probably benign
R1543:Wdr19	UTSW	5	65224690	missense	probably benign	0.06
R1819:Wdr19	UTSW	5	65212891	missense	possibly damaging	0.59
R1971:Wdr19	UTSW	5	65241160	splice site	probably benign
R2190:Wdr19	UTSW	5	65244166	missense	possibly damaging	0.89
R2274:Wdr19	UTSW	5	65240991	missense	possibly damaging	0.62
R3106:Wdr19	UTSW	5	65202623	missense	probably benign	0.20
R3753:Wdr19	UTSW	5	65224726	missense	probably damaging	1.00
R3893:Wdr19	UTSW	5	65228292	missense	possibly damaging	0.64
R4609:Wdr19	UTSW	5	65228542	missense	possibly damaging	0.83
R5284:Wdr19	UTSW	5	65225409	missense	probably damaging	1.00
R5328:Wdr19	UTSW	5	65244179	missense	probably damaging	1.00
R5530:Wdr19	UTSW	5	65228219	missense	probably benign
R5837:Wdr19	UTSW	5	65202957	missense	probably benign	0.08
R5902:Wdr19	UTSW	5	65227139	missense	probably benign	0.09
R6419:Wdr19	UTSW	5	65215893	missense	possibly damaging	0.63
R6495:Wdr19	UTSW	5	65258123	missense	probably benign	0.00
R6916:Wdr19	UTSW	5	65225334	missense	possibly damaging	0.64
R7020:Wdr19	UTSW	5	65256314	missense	probably damaging	0.99
R7190:Wdr19	UTSW	5	65240862	missense	probably benign	0.35
X0028:Wdr19	UTSW	5	65244144	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGTTAGCGTTTAACACATCCAGC -3'
(R):5'- TGTATCAGACAACACGCTAGG -3'

Posted On

2017-07-14