Incidental Mutation 'R6065:Aff1'
ID 484000
Institutional Source Beutler Lab
Gene Symbol Aff1
Ensembl Gene ENSMUSG00000029313
Gene Name AF4/FMR2 family, member 1
Synonyms 9630032B01Rik, Af4, Rob, Mllt2h
MMRRC Submission 044229-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.381) question?
Stock # R6065 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 103692374-103855322 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103842252 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 871 (S871P)
Ref Sequence ENSEMBL: ENSMUSP00000031256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031256] [ENSMUST00000054979] [ENSMUST00000153165]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000031256
AA Change: S871P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031256
Gene: ENSMUSG00000029313
AA Change: S871P

DomainStartEndE-ValueType
Pfam:AF-4 16 1223 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054979
AA Change: S863P

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000059744
Gene: ENSMUSG00000029313
AA Change: S863P

DomainStartEndE-ValueType
Pfam:AF-4 8 1216 N/A PFAM
Predicted Effect silent
Transcript: ENSMUST00000153165
SMART Domains Protein: ENSMUSP00000119631
Gene: ENSMUSG00000029313

DomainStartEndE-ValueType
Pfam:AF-4 16 871 N/A PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the AF4/ lymphoid nuclear protein related to AF4/Fragile X E mental retardation syndrome family of proteins, which have been implicated in human childhood lymphoblastic leukemia, Fragile X E site mental retardation, and ataxia. It is the prevalent mixed-lineage leukemia fusion gene associated with spontaneous acute lymphoblastic leukemia. Members of this family have three conserved domains: an N-terminal homology domain, an AF4/ lymphoid nuclear protein related to AF4/Fragile X E mental retardation syndrome domain, and a C-terminal homology domain. Knockout of the mouse gene by homologous recombination severely affects early events in lymphopoiesis, including precursor proliferation or recruitment, but is dispensable for terminal differentiation. In addition, an autosomal dominant missense mutation results in several phenotypes including ataxia and adult-onset Purkinje cell loss in the cerebellum, indicating a role in Purkinje cell maintenance and function. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired B and T cell development. Heterozygotes for an ENU-induced mutation exhibit small size, ataxia, adult-onset Purkinje cell loss, cataracts, reduced survival, and low fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
BC055324 A T 1: 163,959,388 L704Q probably benign Het
BC055324 A G 1: 163,987,688 M88T probably damaging Het
Ccdc150 T C 1: 54,263,599 I126T possibly damaging Het
Ccdc87 A T 19: 4,841,240 M587L probably benign Het
Cd300ld2 G A 11: 115,012,602 probably benign Het
Chsy3 GT G 18: 59,176,166 163 probably null Het
Dchs1 T C 7: 105,755,421 D2638G probably damaging Het
Dnah5 A T 15: 28,230,468 I171F possibly damaging Het
Dnah9 T C 11: 65,855,338 D3983G probably benign Het
Dnah9 A G 11: 66,145,397 S396P possibly damaging Het
Fbxw15 T A 9: 109,568,178 D18V probably damaging Het
Fcnb A C 2: 28,079,910 C106G probably damaging Het
Gm3453 T C 14: 5,978,233 T57A probably damaging Het
Grin2a T C 16: 9,761,907 D164G possibly damaging Het
Hmcn1 C T 1: 150,770,330 V706I probably benign Het
Kcnj12 C T 11: 61,069,877 L334F probably damaging Het
Lama3 T C 18: 12,469,928 Y1057H possibly damaging Het
Mycbpap T C 11: 94,508,187 probably null Het
Myo18b A G 5: 112,692,781 L2382P probably benign Het
Ngef T A 1: 87,477,648 N680I probably damaging Het
Nop2 A G 6: 125,144,565 H770R probably benign Het
Pcdhgc3 A G 18: 37,807,676 T377A possibly damaging Het
Prl7b1 T C 13: 27,604,546 K109E probably benign Het
Ptprk C T 10: 28,475,170 T553I probably damaging Het
Rab3d T C 9: 21,910,519 T209A probably benign Het
Ralgapa1 A G 12: 55,757,924 probably null Het
Rspry1 T C 8: 94,622,987 M1T probably null Het
Sec13 G T 6: 113,730,832 P176T probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc4a7 C A 14: 14,739,836 T236K probably benign Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Syt2 A G 1: 134,747,557 N382S probably benign Het
Tm7sf2 A G 19: 6,063,386 M345T possibly damaging Het
Ubr4 T G 4: 139,421,238 C1678G probably damaging Het
Urb1 A G 16: 90,803,332 S188P probably benign Het
Vmn2r82 A G 10: 79,385,376 S524G probably damaging Het
Wdr19 A G 5: 65,221,713 N233S probably benign Het
Other mutations in Aff1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Aff1 APN 5 103784077 missense probably damaging 1.00
IGL02060:Aff1 APN 5 103783849 missense possibly damaging 0.51
IGL02081:Aff1 APN 5 103834305 missense probably damaging 1.00
IGL02108:Aff1 APN 5 103811109 critical splice donor site probably null
IGL03056:Aff1 APN 5 103811081 missense probably damaging 0.99
IGL03332:Aff1 APN 5 103841105 nonsense probably null
IGL03340:Aff1 APN 5 103783804 missense possibly damaging 0.76
IGL03382:Aff1 APN 5 103841060 missense possibly damaging 0.86
PIT4495001:Aff1 UTSW 5 103849525 missense probably benign 0.16
R0013:Aff1 UTSW 5 103828484 nonsense probably null
R0219:Aff1 UTSW 5 103811040 splice site probably benign
R0520:Aff1 UTSW 5 103847751 nonsense probably null
R0607:Aff1 UTSW 5 103828454 missense probably damaging 1.00
R0883:Aff1 UTSW 5 103826138 splice site probably benign
R1662:Aff1 UTSW 5 103841057 missense probably damaging 0.99
R1730:Aff1 UTSW 5 103833512 missense probably damaging 1.00
R1850:Aff1 UTSW 5 103833907 missense probably damaging 1.00
R3411:Aff1 UTSW 5 103754706 start codon destroyed probably null 0.53
R4007:Aff1 UTSW 5 103784222 missense probably benign 0.15
R4207:Aff1 UTSW 5 103818988 critical splice donor site probably null
R4702:Aff1 UTSW 5 103811069 missense probably damaging 1.00
R4730:Aff1 UTSW 5 103843073 missense possibly damaging 0.95
R4784:Aff1 UTSW 5 103847039 nonsense probably null
R5166:Aff1 UTSW 5 103754657 start gained probably benign
R5294:Aff1 UTSW 5 103811157 intron probably benign
R5435:Aff1 UTSW 5 103754332 unclassified probably benign
R5436:Aff1 UTSW 5 103783870 missense probably damaging 1.00
R6114:Aff1 UTSW 5 103842297 missense probably damaging 0.97
R6298:Aff1 UTSW 5 103754720 missense possibly damaging 0.68
R7095:Aff1 UTSW 5 103843085 missense probably damaging 0.97
R7261:Aff1 UTSW 5 103828379 missense probably damaging 0.97
R7350:Aff1 UTSW 5 103847092 missense probably benign 0.28
R7423:Aff1 UTSW 5 103847101 missense probably damaging 1.00
R7469:Aff1 UTSW 5 103833547 missense probably benign 0.00
R7604:Aff1 UTSW 5 103847809 missense probably benign 0.09
R7607:Aff1 UTSW 5 103849459 missense possibly damaging 0.72
R8014:Aff1 UTSW 5 103833869 missense possibly damaging 0.82
R8219:Aff1 UTSW 5 103846333 missense probably damaging 1.00
R8315:Aff1 UTSW 5 103811090 missense probably damaging 0.99
R8837:Aff1 UTSW 5 103834212 missense possibly damaging 0.77
R8957:Aff1 UTSW 5 103833768 missense possibly damaging 0.82
R9159:Aff1 UTSW 5 103842265 missense possibly damaging 0.89
R9377:Aff1 UTSW 5 103833819 missense probably damaging 0.96
R9381:Aff1 UTSW 5 103833867 missense possibly damaging 0.85
R9705:Aff1 UTSW 5 103784410 missense possibly damaging 0.88
R9725:Aff1 UTSW 5 103847065 missense probably damaging 0.99
R9764:Aff1 UTSW 5 103849499 missense probably damaging 1.00
Z1177:Aff1 UTSW 5 103783753 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- AGGTTGGTGCAAACCCTACAG -3'
(R):5'- TACCTTGTGTTCAGAGCCCC -3'
Posted On 2017-07-14