Incidental Mutation 'R6065:Nop2'
ID484003
Institutional Source Beutler Lab
Gene Symbol Nop2
Ensembl Gene ENSMUSG00000038279
Gene NameNOP2 nucleolar protein
Synonyms120kDa, Nol1
MMRRC Submission 044229-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R6065 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location125131909-125144753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125144565 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 770 (H770R)
Ref Sequence ENSEMBL: ENSMUSP00000047123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044200] [ENSMUST00000117675] [ENSMUST00000119527] [ENSMUST00000144364]
Predicted Effect probably benign
Transcript: ENSMUST00000044200
AA Change: H770R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047123
Gene: ENSMUSG00000038279
AA Change: H770R

DomainStartEndE-ValueType
low complexity region 41 57 N/A INTRINSIC
low complexity region 97 109 N/A INTRINSIC
low complexity region 166 176 N/A INTRINSIC
Pfam:Methyltr_RsmF_N 268 359 2.9e-12 PFAM
Pfam:Nol1_Nop2_Fmu 362 570 2e-86 PFAM
Pfam:P120R 609 630 2.7e-11 PFAM
Pfam:P120R 663 685 1.1e-12 PFAM
low complexity region 729 745 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117675
SMART Domains Protein: ENSMUSP00000113088
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
coiled coil region 190 242 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 381 392 N/A INTRINSIC
PDB:1GK4|F 393 459 6e-7 PDB
low complexity region 474 497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119527
SMART Domains Protein: ENSMUSP00000113376
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
coiled coil region 190 242 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
low complexity region 378 389 N/A INTRINSIC
PDB:1GK4|F 390 456 6e-7 PDB
low complexity region 471 494 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141230
Predicted Effect probably benign
Transcript: ENSMUST00000144364
SMART Domains Protein: ENSMUSP00000116701
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
coiled coil region 21 58 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
coiled coil region 190 242 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148835
SMART Domains Protein: ENSMUSP00000115080
Gene: ENSMUSG00000038271

DomainStartEndE-ValueType
Filament 34 348 4.99e-2 SMART
low complexity region 356 379 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150417
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153006
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff1 T C 5: 103,842,252 S871P probably damaging Het
BC055324 A T 1: 163,959,388 L704Q probably benign Het
BC055324 A G 1: 163,987,688 M88T probably damaging Het
Ccdc150 T C 1: 54,263,599 I126T possibly damaging Het
Ccdc87 A T 19: 4,841,240 M587L probably benign Het
Cd300ld2 G A 11: 115,012,602 probably benign Het
Chsy3 GT G 18: 59,176,166 probably null Het
Dchs1 T C 7: 105,755,421 D2638G probably damaging Het
Dnah5 A T 15: 28,230,468 I171F possibly damaging Het
Dnah9 T C 11: 65,855,338 D3983G probably benign Het
Dnah9 A G 11: 66,145,397 S396P possibly damaging Het
Fbxw15 T A 9: 109,568,178 D18V probably damaging Het
Fcnb A C 2: 28,079,910 C106G probably damaging Het
Gm3453 T C 14: 5,978,233 T57A probably damaging Het
Grin2a T C 16: 9,761,907 D164G possibly damaging Het
Hmcn1 C T 1: 150,770,330 V706I probably benign Het
Kcnj12 C T 11: 61,069,877 L334F probably damaging Het
Lama3 T C 18: 12,469,928 Y1057H possibly damaging Het
Mycbpap T C 11: 94,508,187 probably null Het
Myo18b A G 5: 112,692,781 L2382P probably benign Het
Ngef T A 1: 87,477,648 N680I probably damaging Het
Pcdhgc3 A G 18: 37,807,676 T377A possibly damaging Het
Prl7b1 T C 13: 27,604,546 K109E probably benign Het
Ptprk C T 10: 28,475,170 T553I probably damaging Het
Rab3d T C 9: 21,910,519 T209A probably benign Het
Ralgapa1 A G 12: 55,757,924 probably null Het
Rspry1 T C 8: 94,622,987 M1T probably null Het
Sec13 G T 6: 113,730,832 P176T probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc4a7 C A 14: 14,739,836 T236K probably benign Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Syt2 A G 1: 134,747,557 N382S probably benign Het
Tm7sf2 A G 19: 6,063,386 M345T possibly damaging Het
Ubr4 T G 4: 139,421,238 C1678G probably damaging Het
Urb1 A G 16: 90,803,332 S188P probably benign Het
Vmn2r82 A G 10: 79,385,376 S524G probably damaging Het
Wdr19 A G 5: 65,221,713 N233S probably benign Het
Other mutations in Nop2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00787:Nop2 APN 6 125133546 missense probably damaging 1.00
IGL00913:Nop2 APN 6 125139821 missense probably damaging 1.00
IGL02568:Nop2 APN 6 125140850 missense probably damaging 1.00
IGL02850:Nop2 APN 6 125144085 missense possibly damaging 0.67
IGL02850:Nop2 APN 6 125144070 missense probably benign 0.01
IGL02851:Nop2 APN 6 125144085 missense possibly damaging 0.67
IGL02851:Nop2 APN 6 125144070 missense probably benign 0.01
IGL03144:Nop2 APN 6 125137512 critical splice donor site probably null
IGL03338:Nop2 APN 6 125139732 splice site probably null
R0211:Nop2 UTSW 6 125141344 missense probably damaging 1.00
R0211:Nop2 UTSW 6 125141344 missense probably damaging 1.00
R0486:Nop2 UTSW 6 125140673 missense probably null 0.14
R0627:Nop2 UTSW 6 125139704 missense possibly damaging 0.90
R1022:Nop2 UTSW 6 125137186 missense probably benign 0.02
R1024:Nop2 UTSW 6 125137186 missense probably benign 0.02
R1068:Nop2 UTSW 6 125132279 missense probably damaging 0.99
R1750:Nop2 UTSW 6 125137638 missense probably benign 0.00
R1847:Nop2 UTSW 6 125137079 unclassified probably benign
R1940:Nop2 UTSW 6 125134634 missense probably benign 0.43
R1972:Nop2 UTSW 6 125134639 missense probably benign 0.02
R2059:Nop2 UTSW 6 125139860 missense probably null 0.95
R2100:Nop2 UTSW 6 125140822 missense probably damaging 1.00
R3123:Nop2 UTSW 6 125132201 utr 5 prime probably benign
R3124:Nop2 UTSW 6 125132201 utr 5 prime probably benign
R3160:Nop2 UTSW 6 125134592 missense probably benign 0.00
R3162:Nop2 UTSW 6 125134592 missense probably benign 0.00
R4521:Nop2 UTSW 6 125133552 missense probably damaging 1.00
R4522:Nop2 UTSW 6 125133552 missense probably damaging 1.00
R4523:Nop2 UTSW 6 125133552 missense probably damaging 1.00
R4524:Nop2 UTSW 6 125133552 missense probably damaging 1.00
R4571:Nop2 UTSW 6 125140881 critical splice donor site probably null
R4695:Nop2 UTSW 6 125144556 missense probably benign 0.00
R4747:Nop2 UTSW 6 125137094 missense probably benign
R5010:Nop2 UTSW 6 125133763 missense probably benign 0.00
R5385:Nop2 UTSW 6 125144361 missense probably benign
R5455:Nop2 UTSW 6 125140643 missense probably benign 0.19
R5567:Nop2 UTSW 6 125133763 missense probably benign 0.00
R5914:Nop2 UTSW 6 125134728 missense probably benign 0.01
R5993:Nop2 UTSW 6 125144019 missense probably benign 0.00
R6031:Nop2 UTSW 6 125133566 critical splice donor site probably null
R6031:Nop2 UTSW 6 125133566 critical splice donor site probably null
R6352:Nop2 UTSW 6 125137207 missense probably benign
R6436:Nop2 UTSW 6 125137311 missense probably benign 0.01
R7393:Nop2 UTSW 6 125133546 nonsense probably null
R7499:Nop2 UTSW 6 125144208 missense possibly damaging 0.75
R8029:Nop2 UTSW 6 125144420 missense possibly damaging 0.77
R8059:Nop2 UTSW 6 125140812 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCCTCTGAAATCCGTGCTG -3'
(R):5'- AGTGCACAACTGTCTCTCC -3'

Posted On2017-07-14