Mutagenetix > Incidental Mutation

Incidental Mutation 'R0519:Rad54l2'

48401

Institutional Source

Beutler Lab

Gene Symbol

Rad54l2

Ensembl Gene

ENSMUSG00000040661

Gene Name

RAD54 like 2 (S. cerevisiae)

Synonyms

Srisnf2l, G630026H09Rik, Arip4

MMRRC Submission

038712-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0519 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

106688082-106789194 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 106708299 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 756 (F756L)

Ref Sequence

ENSEMBL: ENSMUSP00000045454 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046502]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000046502
AA Change: F756L

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000045454
Gene: ENSMUSG00000040661
AA Change: F756L

Domain	Start	End	E-Value	Type
coiled coil region	20	49	N/A	INTRINSIC
low complexity region	73	85	N/A	INTRINSIC
low complexity region	130	146	N/A	INTRINSIC
low complexity region	186	200	N/A	INTRINSIC
low complexity region	215	229	N/A	INTRINSIC
DEXDc	267	520	4.21e-20	SMART
HELICc	751	854	1.88e-17	SMART
low complexity region	959	976	N/A	INTRINSIC
low complexity region	1348	1368	N/A	INTRINSIC
low complexity region	1453	1460	N/A	INTRINSIC

Meta Mutation Damage Score

0.5211

Coding Region Coverage

1x: 99.6%
3x: 98.8%
10x: 96.6%
20x: 93.2%

Validation Efficiency

99% (74/75)

MGI Phenotype

PHENOTYPE: Homozygous null embryos show delayed growth, reduced cell proliferation, increased apoptosis and die by E11.5. At E9.5-E10.5, most major organs are smaller and the neural tube is shrunk in some cases. Mutant MEFs cease to grow after 2-3 passages showing increased apoptosis and reduced DNA synthesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700028K03Rik	A	G	5: 107,548,201	R168G	probably benign	Het
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
2810004N23Rik	C	T	8: 124,839,929	G251R	possibly damaging	Het
3425401B19Rik	A	G	14: 32,662,962	S349P	possibly damaging	Het
Ackr4	A	G	9: 104,099,451	V99A	probably benign	Het
Asxl3	A	G	18: 22,523,520	Q1529R	possibly damaging	Het
Atg12	T	C	18: 46,741,410	E46G	probably benign	Het
Cdcp2	A	G	4: 107,107,192		probably benign	Het
Clasrp	A	G	7: 19,584,164		probably benign	Het
Clip2	A	G	5: 134,516,151	V383A	probably benign	Het
Cntln	C	T	4: 85,005,053		probably benign	Het
Colgalt2	G	T	1: 152,508,561	A551S	possibly damaging	Het
Csmd2	A	C	4: 128,487,005	Y2118S	possibly damaging	Het
Dip2c	T	A	13: 9,563,208	V415E	probably damaging	Het
Dpy19l2	C	T	9: 24,558,095	R755Q	probably benign	Het
Dsn1	A	T	2: 156,998,713		probably benign	Het
Dtd2	T	C	12: 52,004,959		probably benign	Het
Dync1i1	A	G	6: 6,027,399	T602A	probably benign	Het
Ercc6	A	C	14: 32,526,842	D450A	probably damaging	Het
Fgf12	A	T	16: 28,189,628	V104D	probably benign	Het
Frem1	A	T	4: 82,970,633		probably null	Het
Gcgr	G	T	11: 120,536,156	W88L	probably damaging	Het
Glb1	ACCC	ACC	9: 114,421,744		probably null	Het
Hapln1	A	G	13: 89,584,716		probably benign	Het
Hmgn3	T	C	9: 83,112,248	E40G	probably damaging	Het
Hsdl1	G	A	8: 119,565,711	A255V	probably damaging	Het
Hyls1	T	C	9: 35,561,203	K306E	probably damaging	Het
Jcad	C	T	18: 4,649,122		probably benign	Het
Kif14	C	A	1: 136,469,147	A397E	probably damaging	Het
Lcmt2	A	T	2: 121,139,344		probably null	Het
Lifr	T	C	15: 7,177,580	L524P	probably damaging	Het
Ly6g6f	T	C	17: 35,082,852	K209E	possibly damaging	Het
Macf1	G	A	4: 123,471,320	T1651I	probably benign	Het
Mapk4	T	C	18: 73,970,321	D39G	probably damaging	Het
Mbl1	A	G	14: 41,158,565	M137V	probably damaging	Het
Mcm10	G	A	2: 5,008,545	S92L	probably benign	Het
Mug1	A	G	6: 121,851,424	K265R	possibly damaging	Het
Mxra7	A	G	11: 116,810,786		probably null	Het
Neu3	G	A	7: 99,823,317		probably benign	Het
Nsd1	A	G	13: 55,312,835	T2395A	probably benign	Het
Olfr1034	A	T	2: 86,047,067	Y195F	probably benign	Het
Olfr3	T	A	2: 36,812,615	H159L	probably damaging	Het
Olfr750	T	A	14: 51,071,157	I79F	probably damaging	Het
Olfr854	A	T	9: 19,566,949	I145N	probably benign	Het
Osgepl1	T	C	1: 53,321,096	V327A	probably damaging	Het
Pcdhb21	T	C	18: 37,516,032	V738A	possibly damaging	Het
Plekha8	A	T	6: 54,622,107		probably benign	Het
Ptprq	A	C	10: 107,538,920		probably benign	Het
Pus10	T	A	11: 23,711,201	F263Y	probably benign	Het
Rad54b	A	T	4: 11,599,809	I338F	probably damaging	Het
Scn11a	A	G	9: 119,790,119	L719P	probably damaging	Het
Slc2a2	G	A	3: 28,718,816	V253I	possibly damaging	Het
Slc39a4	A	T	15: 76,615,138	N192K	probably benign	Het
Soat1	T	A	1: 156,441,246	I245F	probably damaging	Het
Sorcs2	G	A	5: 36,031,190	A858V	probably benign	Het
Tcim	T	C	8: 24,438,635	T88A	possibly damaging	Het
Tecta	G	A	9: 42,347,892		probably benign	Het
Tgm5	C	A	2: 121,048,895	L553F	probably damaging	Het
Tjp1	A	G	7: 65,302,921	V1555A	probably benign	Het
Tmem214	A	C	5: 30,869,668	M1L	probably null	Het
Togaram1	T	C	12: 64,966,002		probably benign	Het
Topaz1	C	A	9: 122,749,479	L485I	possibly damaging	Het
Ttn	T	C	2: 76,718,282		probably benign	Het
Ube2o	A	G	11: 116,546,459		probably null	Het
Ubr7	T	A	12: 102,768,206	D246E	probably benign	Het
Vcpkmt	T	C	12: 69,582,328	D132G	probably benign	Het
Vmn2r111	T	A	17: 22,573,121	Q51H	probably benign	Het
Vmn2r95	C	T	17: 18,439,503	P170S	probably damaging	Het
Zbtb38	A	G	9: 96,685,773	I1086T	probably damaging	Het
Zfp444	G	A	7: 6,188,173	A118T	probably benign	Het
Zp2	A	G	7: 120,138,149	I272T	probably damaging	Het

Other mutations in Rad54l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Rad54l2	APN	9	106700561	missense	probably benign
IGL00718:Rad54l2	APN	9	106713455	missense	probably damaging	1.00
IGL00917:Rad54l2	APN	9	106710439	missense	possibly damaging	0.95
IGL01319:Rad54l2	APN	9	106719046	missense	probably benign	0.18
IGL01447:Rad54l2	APN	9	106702772	missense	probably damaging	1.00
IGL01469:Rad54l2	APN	9	106722758	missense	probably damaging	1.00
IGL01836:Rad54l2	APN	9	106716157	missense	probably benign	0.00
IGL02017:Rad54l2	APN	9	106754040	missense	possibly damaging	0.85
IGL02179:Rad54l2	APN	9	106720390	missense	probably damaging	1.00
IGL02348:Rad54l2	APN	9	106720376	missense	probably damaging	1.00
IGL02822:Rad54l2	APN	9	106710407	missense	probably damaging	1.00
IGL03169:Rad54l2	APN	9	106719064	missense	probably benign	0.37
IGL03245:Rad54l2	APN	9	106703628	missense	probably damaging	1.00
IGL03253:Rad54l2	APN	9	106704223	missense	probably damaging	1.00
IGL02988:Rad54l2	UTSW	9	106700585	missense	probably benign
PIT4495001:Rad54l2	UTSW	9	106716144	missense	probably benign	0.02
R0001:Rad54l2	UTSW	9	106708217	missense	probably damaging	0.97
R0069:Rad54l2	UTSW	9	106710365	missense	possibly damaging	0.67
R0069:Rad54l2	UTSW	9	106710365	missense	possibly damaging	0.67
R0114:Rad54l2	UTSW	9	106713455	missense	probably damaging	1.00
R0427:Rad54l2	UTSW	9	106693692	missense	possibly damaging	0.65
R0760:Rad54l2	UTSW	9	106719606	critical splice donor site	probably null
R1018:Rad54l2	UTSW	9	106712390	missense	probably benign	0.32
R1630:Rad54l2	UTSW	9	106703629	missense	possibly damaging	0.79
R1701:Rad54l2	UTSW	9	106700493	critical splice donor site	probably null
R1903:Rad54l2	UTSW	9	106693717	splice site	probably null
R2187:Rad54l2	UTSW	9	106753992	small deletion	probably benign
R2205:Rad54l2	UTSW	9	106717798	missense	probably damaging	1.00
R2566:Rad54l2	UTSW	9	106703626	missense	possibly damaging	0.95
R2983:Rad54l2	UTSW	9	106700590	missense	probably benign	0.10
R3176:Rad54l2	UTSW	9	106753943	critical splice donor site	probably null
R3276:Rad54l2	UTSW	9	106753943	critical splice donor site	probably null
R3718:Rad54l2	UTSW	9	106693527	missense	probably benign
R4063:Rad54l2	UTSW	9	106720414	missense	probably benign	0.10
R4206:Rad54l2	UTSW	9	106717795	missense	probably damaging	1.00
R4271:Rad54l2	UTSW	9	106693626	missense	probably benign	0.22
R4377:Rad54l2	UTSW	9	106693222	missense	probably benign	0.00
R4700:Rad54l2	UTSW	9	106754025	missense	possibly damaging	0.85
R4729:Rad54l2	UTSW	9	106716118	missense	probably benign
R4872:Rad54l2	UTSW	9	106717892	missense	probably damaging	1.00
R4997:Rad54l2	UTSW	9	106722909	missense	possibly damaging	0.70
R5475:Rad54l2	UTSW	9	106705858	missense	probably damaging	1.00
R5658:Rad54l2	UTSW	9	106753992	small deletion	probably benign
R6246:Rad54l2	UTSW	9	106700493	critical splice donor site	probably null
R6248:Rad54l2	UTSW	9	106710338	missense	probably damaging	1.00
R6329:Rad54l2	UTSW	9	106717922	missense	possibly damaging	0.89
R6631:Rad54l2	UTSW	9	106713540	nonsense	probably null
R6773:Rad54l2	UTSW	9	106693317	missense	probably benign
R7148:Rad54l2	UTSW	9	106719119	nonsense	probably null
R7171:Rad54l2	UTSW	9	106713478	missense	probably damaging	1.00
R7226:Rad54l2	UTSW	9	106713472	missense	probably damaging	0.99
R7327:Rad54l2	UTSW	9	106693461	missense	possibly damaging	0.68
R7337:Rad54l2	UTSW	9	106705825	missense	probably damaging	1.00
R7636:Rad54l2	UTSW	9	106720387	missense	probably damaging	1.00
R7659:Rad54l2	UTSW	9	106713578	missense	probably benign	0.11
R7713:Rad54l2	UTSW	9	106717223	missense	probably damaging	1.00
R7748:Rad54l2	UTSW	9	106719034	missense	possibly damaging	0.53
R8021:Rad54l2	UTSW	9	106719641	missense	probably benign	0.00
R8084:Rad54l2	UTSW	9	106713502	missense	possibly damaging	0.63
R8552:Rad54l2	UTSW	9	106693578	missense	possibly damaging	0.77
R8768:Rad54l2	UTSW	9	106719610	missense	probably benign	0.04
R8952:Rad54l2	UTSW	9	106688851	unclassified	probably benign
R8953:Rad54l2	UTSW	9	106693262	missense	probably benign	0.02
R9041:Rad54l2	UTSW	9	106722819	missense	possibly damaging	0.85
R9296:Rad54l2	UTSW	9	106702743	missense	probably damaging	1.00
R9451:Rad54l2	UTSW	9	106708289	missense	probably benign	0.13
R9523:Rad54l2	UTSW	9	106695952	missense	probably damaging	1.00
R9657:Rad54l2	UTSW	9	106704173	missense	probably damaging	0.99
R9757:Rad54l2	UTSW	9	106717921	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCACATATGGTCACACATGCTTG -3'
(R):5'- ACTGCTGAACACTGAGTTAAACCCC -3'

Sequencing Primer
(F):5'- TATCTCTGTAGCCCTAGCAGTGG -3'
(R):5'- ATGGGTCGGTGCTCATAAATC -3'

Posted On

2013-06-12