Incidental Mutation 'R6065:Slc4a7'
ID484018
Institutional Source Beutler Lab
Gene Symbol Slc4a7
Ensembl Gene ENSMUSG00000021733
Gene Namesolute carrier family 4, sodium bicarbonate cotransporter, member 7
SynonymsNBC3, NBCn1, E430014N10Rik
MMRRC Submission 044229-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R6065 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location14702279-14799940 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 14739836 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 236 (T236K)
Ref Sequence ENSEMBL: ENSMUSP00000152950 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057015] [ENSMUST00000223607] [ENSMUST00000223695] [ENSMUST00000223740] [ENSMUST00000223761] [ENSMUST00000223981] [ENSMUST00000224049] [ENSMUST00000224222] [ENSMUST00000224333] [ENSMUST00000224672] [ENSMUST00000224752] [ENSMUST00000225175] [ENSMUST00000225232] [ENSMUST00000225238] [ENSMUST00000225630] [ENSMUST00000225979] [ENSMUST00000226079]
Predicted Effect probably benign
Transcript: ENSMUST00000057015
AA Change: T230K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000058313
Gene: ENSMUSG00000021733
AA Change: T230K

DomainStartEndE-ValueType
low complexity region 57 89 N/A INTRINSIC
Pfam:Band_3_cyto 146 413 1.4e-110 PFAM
Pfam:HCO3_cotransp 456 969 1.6e-242 PFAM
transmembrane domain 977 999 N/A INTRINSIC
coiled coil region 1021 1050 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223607
AA Change: T230K

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000223695
AA Change: T236K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000223740
AA Change: T236K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000223761
AA Change: T230K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000223981
AA Change: T230K

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000224049
AA Change: T236K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000224222
AA Change: T230K

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000224333
AA Change: T236K

PolyPhen 2 Score 0.284 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000224672
AA Change: T236K

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000224752
AA Change: T235K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect unknown
Transcript: ENSMUST00000224952
AA Change: T249K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225078
Predicted Effect probably benign
Transcript: ENSMUST00000225175
AA Change: T230K

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000225232
AA Change: T230K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000225238
AA Change: T230K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225496
Predicted Effect probably benign
Transcript: ENSMUST00000225630
AA Change: T230K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000225979
AA Change: T230K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000226079
AA Change: T230K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a sodium bicarbonate cotransporter. The encoded transmembrane protein appears to transport sodium and bicarbonate ions in a 1:1 ratio, and is thus considered an electroneutral cotransporter. The encoded protein likely plays a critical role in regulation of intracellular pH involved in visual and auditory sensory transmission. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a disruption at this locus display defects of the auditory and visual systems similar to those observed in patients with Ushers syndrome. Mice homozygous for a gene trap allele exhibit disruption in sodium/bicarbonate function that impacts vasodilation and hypertension. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff1 T C 5: 103,842,252 S871P probably damaging Het
BC055324 A T 1: 163,959,388 L704Q probably benign Het
BC055324 A G 1: 163,987,688 M88T probably damaging Het
Ccdc150 T C 1: 54,263,599 I126T possibly damaging Het
Ccdc87 A T 19: 4,841,240 M587L probably benign Het
Cd300ld2 G A 11: 115,012,602 probably benign Het
Chsy3 GT G 18: 59,176,166 probably null Het
Dchs1 T C 7: 105,755,421 D2638G probably damaging Het
Dnah5 A T 15: 28,230,468 I171F possibly damaging Het
Dnah9 T C 11: 65,855,338 D3983G probably benign Het
Dnah9 A G 11: 66,145,397 S396P possibly damaging Het
Fbxw15 T A 9: 109,568,178 D18V probably damaging Het
Fcnb A C 2: 28,079,910 C106G probably damaging Het
Gm3453 T C 14: 5,978,233 T57A probably damaging Het
Grin2a T C 16: 9,761,907 D164G possibly damaging Het
Hmcn1 C T 1: 150,770,330 V706I probably benign Het
Kcnj12 C T 11: 61,069,877 L334F probably damaging Het
Lama3 T C 18: 12,469,928 Y1057H possibly damaging Het
Mycbpap T C 11: 94,508,187 probably null Het
Myo18b A G 5: 112,692,781 L2382P probably benign Het
Ngef T A 1: 87,477,648 N680I probably damaging Het
Nop2 A G 6: 125,144,565 H770R probably benign Het
Pcdhgc3 A G 18: 37,807,676 T377A possibly damaging Het
Prl7b1 T C 13: 27,604,546 K109E probably benign Het
Ptprk C T 10: 28,475,170 T553I probably damaging Het
Rab3d T C 9: 21,910,519 T209A probably benign Het
Ralgapa1 A G 12: 55,757,924 probably null Het
Rspry1 T C 8: 94,622,987 M1T probably null Het
Sec13 G T 6: 113,730,832 P176T probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Syt2 A G 1: 134,747,557 N382S probably benign Het
Tm7sf2 A G 19: 6,063,386 M345T possibly damaging Het
Ubr4 T G 4: 139,421,238 C1678G probably damaging Het
Urb1 A G 16: 90,803,332 S188P probably benign Het
Vmn2r82 A G 10: 79,385,376 S524G probably damaging Het
Wdr19 A G 5: 65,221,713 N233S probably benign Het
Other mutations in Slc4a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00974:Slc4a7 APN 14 14760292 missense probably benign 0.18
IGL01468:Slc4a7 APN 14 14737480 missense probably damaging 1.00
IGL01863:Slc4a7 APN 14 14762430 missense probably damaging 0.97
IGL03122:Slc4a7 APN 14 14782040 splice site probably benign
R0020:Slc4a7 UTSW 14 14796108 missense probably benign
R0403:Slc4a7 UTSW 14 14766808 missense probably benign 0.02
R0410:Slc4a7 UTSW 14 14738299 missense probably damaging 1.00
R0624:Slc4a7 UTSW 14 14794059 critical splice donor site probably null
R0631:Slc4a7 UTSW 14 14757382 missense probably damaging 1.00
R1128:Slc4a7 UTSW 14 14733832 missense probably damaging 1.00
R1556:Slc4a7 UTSW 14 14778872 missense probably benign 0.01
R1672:Slc4a7 UTSW 14 14760247 missense possibly damaging 0.91
R1711:Slc4a7 UTSW 14 14765709 missense probably benign 0.45
R1870:Slc4a7 UTSW 14 14737509 critical splice donor site probably null
R1939:Slc4a7 UTSW 14 14748581 missense probably damaging 1.00
R2012:Slc4a7 UTSW 14 14733727 nonsense probably null
R2042:Slc4a7 UTSW 14 14737386 missense probably damaging 1.00
R2064:Slc4a7 UTSW 14 14733773 missense probably damaging 1.00
R2404:Slc4a7 UTSW 14 14733733 missense probably damaging 1.00
R2880:Slc4a7 UTSW 14 14773277 missense probably damaging 1.00
R3729:Slc4a7 UTSW 14 14729276 missense probably damaging 1.00
R4368:Slc4a7 UTSW 14 14733775 missense probably damaging 1.00
R4395:Slc4a7 UTSW 14 14765665 missense probably damaging 1.00
R4432:Slc4a7 UTSW 14 14757323 missense probably damaging 1.00
R4592:Slc4a7 UTSW 14 14778850 missense probably damaging 1.00
R4705:Slc4a7 UTSW 14 14733856 missense probably damaging 1.00
R4743:Slc4a7 UTSW 14 14796073 splice site probably null
R4765:Slc4a7 UTSW 14 14762414 missense probably damaging 1.00
R4831:Slc4a7 UTSW 14 14772699 critical splice donor site probably null
R4845:Slc4a7 UTSW 14 14733803 missense probably damaging 1.00
R4880:Slc4a7 UTSW 14 14757342 missense probably damaging 1.00
R4948:Slc4a7 UTSW 14 14771283 missense possibly damaging 0.68
R5348:Slc4a7 UTSW 14 14786310 missense probably benign 0.02
R5385:Slc4a7 UTSW 14 14773345 missense possibly damaging 0.94
R5418:Slc4a7 UTSW 14 14760280 missense probably benign 0.25
R5480:Slc4a7 UTSW 14 14782138 missense probably damaging 1.00
R5842:Slc4a7 UTSW 14 14778866 missense probably damaging 1.00
R5919:Slc4a7 UTSW 14 14791092 missense probably benign
R6063:Slc4a7 UTSW 14 14793964 missense possibly damaging 0.60
R6549:Slc4a7 UTSW 14 14748564 missense probably damaging 1.00
R6845:Slc4a7 UTSW 14 14775000 missense probably damaging 1.00
R6870:Slc4a7 UTSW 14 14733846 missense probably damaging 1.00
R6881:Slc4a7 UTSW 14 14737452 missense probably benign 0.43
R6962:Slc4a7 UTSW 14 14746021 missense probably damaging 0.99
R7099:Slc4a7 UTSW 14 14733750 missense probably damaging 1.00
R7180:Slc4a7 UTSW 14 14765580 missense probably damaging 1.00
R7346:Slc4a7 UTSW 14 14775000 missense probably damaging 1.00
R7378:Slc4a7 UTSW 14 14757421 missense probably damaging 1.00
R7646:Slc4a7 UTSW 14 14773348 missense probably benign 0.01
R7647:Slc4a7 UTSW 14 14773348 missense probably benign 0.01
R7648:Slc4a7 UTSW 14 14773348 missense probably benign 0.01
R7650:Slc4a7 UTSW 14 14773348 missense probably benign 0.01
R7857:Slc4a7 UTSW 14 14772624 missense probably benign 0.00
R7892:Slc4a7 UTSW 14 14773348 missense probably benign 0.01
R7940:Slc4a7 UTSW 14 14772624 missense probably benign 0.00
R7975:Slc4a7 UTSW 14 14773348 missense probably benign 0.01
X0067:Slc4a7 UTSW 14 14771276 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCCTGTGCCATTGAATATTTAGC -3'
(R):5'- ACCACCTTTCTTGCAACACG -3'

Posted On2017-07-14