Incidental Mutation 'R6065:Tm7sf2'
ID484027
Institutional Source Beutler Lab
Gene Symbol Tm7sf2
Ensembl Gene ENSMUSG00000024799
Gene Nametransmembrane 7 superfamily member 2
Synonyms3110041O18Rik, ANG1
MMRRC Submission 044229-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6065 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location6062821-6077197 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6063386 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 345 (M345T)
Ref Sequence ENSEMBL: ENSMUSP00000109171 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025711] [ENSMUST00000025713] [ENSMUST00000043074] [ENSMUST00000113543] [ENSMUST00000159084] [ENSMUST00000159832] [ENSMUST00000160028] [ENSMUST00000161090] [ENSMUST00000161528] [ENSMUST00000161718] [ENSMUST00000162575] [ENSMUST00000162726] [ENSMUST00000162810] [ENSMUST00000178310] [ENSMUST00000179142]
Predicted Effect probably benign
Transcript: ENSMUST00000025711
SMART Domains Protein: ENSMUSP00000025711
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:COG2 56 191 2.6e-10 PFAM
Pfam:DUF2450 62 250 2.3e-14 PFAM
Pfam:Vps51 63 149 1.1e-26 PFAM
Pfam:Dor1 75 246 1.8e-19 PFAM
Pfam:Zw10 83 291 2.2e-8 PFAM
Pfam:Sec5 101 275 6.5e-24 PFAM
low complexity region 377 391 N/A INTRINSIC
low complexity region 523 532 N/A INTRINSIC
low complexity region 743 758 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000025713
AA Change: M345T

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025713
Gene: ENSMUSG00000024799
AA Change: M345T

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 418 1.6e-141 PFAM
Pfam:DUF1295 250 409 9.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043074
SMART Domains Protein: ENSMUSP00000042835
Gene: ENSMUSG00000038274

DomainStartEndE-ValueType
UBQ 1 70 2.55e-20 SMART
Pfam:Ribosomal_S30 75 133 9.4e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000113543
AA Change: M345T

PolyPhen 2 Score 0.650 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000109171
Gene: ENSMUSG00000024799
AA Change: M345T

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 373 9.9e-112 PFAM
Pfam:DUF1295 249 396 2.6e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159084
AA Change: M318T

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124868
Gene: ENSMUSG00000024799
AA Change: M318T

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 300 6.4e-75 PFAM
Pfam:ERG4_ERG24 292 391 2.2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159475
Predicted Effect probably benign
Transcript: ENSMUST00000159832
SMART Domains Protein: ENSMUSP00000123994
Gene: ENSMUSG00000024797

DomainStartEndE-ValueType
low complexity region 2 25 N/A INTRINSIC
Pfam:COG2 56 191 2e-10 PFAM
Pfam:DUF2450 62 250 1.9e-14 PFAM
Pfam:Vps51 63 149 8.3e-27 PFAM
Pfam:Dor1 75 246 1.8e-19 PFAM
Pfam:Sec5 101 275 1.6e-19 PFAM
low complexity region 276 292 N/A INTRINSIC
low complexity region 377 391 N/A INTRINSIC
low complexity region 523 532 N/A INTRINSIC
low complexity region 743 758 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159836
Predicted Effect probably benign
Transcript: ENSMUST00000160028
SMART Domains Protein: ENSMUSP00000124847
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 39 61 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160417
Predicted Effect probably benign
Transcript: ENSMUST00000161090
SMART Domains Protein: ENSMUSP00000125543
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161528
SMART Domains Protein: ENSMUSP00000123989
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 7 109 5.3e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161634
Predicted Effect probably benign
Transcript: ENSMUST00000161718
AA Change: M145T

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124283
Gene: ENSMUSG00000024799
AA Change: M145T

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 1 197 5.7e-86 PFAM
Pfam:DUF1295 46 185 1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162549
Predicted Effect probably benign
Transcript: ENSMUST00000162575
SMART Domains Protein: ENSMUSP00000125586
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:ERG4_ERG24 51 229 5.5e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162721
Predicted Effect probably benign
Transcript: ENSMUST00000162726
SMART Domains Protein: ENSMUSP00000134031
Gene: ENSMUSG00000075227

DomainStartEndE-ValueType
Pfam:zf-HIT 3 36 2e-15 PFAM
low complexity region 54 97 N/A INTRINSIC
low complexity region 120 140 N/A INTRINSIC
low complexity region 167 205 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162810
SMART Domains Protein: ENSMUSP00000124825
Gene: ENSMUSG00000024799

DomainStartEndE-ValueType
Pfam:ERG4_ERG24 9 124 6.9e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178310
SMART Domains Protein: ENSMUSP00000136803
Gene: ENSMUSG00000038274

DomainStartEndE-ValueType
UBQ 1 70 2.55e-20 SMART
Pfam:Ribosomal_S30 75 133 9.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179142
SMART Domains Protein: ENSMUSP00000136358
Gene: ENSMUSG00000038274

DomainStartEndE-ValueType
UBQ 1 70 2.55e-20 SMART
Pfam:Ribosomal_S30 75 132 6.7e-34 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit normal plasma cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff1 T C 5: 103,842,252 S871P probably damaging Het
BC055324 A T 1: 163,959,388 L704Q probably benign Het
BC055324 A G 1: 163,987,688 M88T probably damaging Het
Ccdc150 T C 1: 54,263,599 I126T possibly damaging Het
Ccdc87 A T 19: 4,841,240 M587L probably benign Het
Cd300ld2 G A 11: 115,012,602 probably benign Het
Chsy3 GT G 18: 59,176,166 probably null Het
Dchs1 T C 7: 105,755,421 D2638G probably damaging Het
Dnah5 A T 15: 28,230,468 I171F possibly damaging Het
Dnah9 T C 11: 65,855,338 D3983G probably benign Het
Dnah9 A G 11: 66,145,397 S396P possibly damaging Het
Fbxw15 T A 9: 109,568,178 D18V probably damaging Het
Fcnb A C 2: 28,079,910 C106G probably damaging Het
Gm3453 T C 14: 5,978,233 T57A probably damaging Het
Grin2a T C 16: 9,761,907 D164G possibly damaging Het
Hmcn1 C T 1: 150,770,330 V706I probably benign Het
Kcnj12 C T 11: 61,069,877 L334F probably damaging Het
Lama3 T C 18: 12,469,928 Y1057H possibly damaging Het
Mycbpap T C 11: 94,508,187 probably null Het
Myo18b A G 5: 112,692,781 L2382P probably benign Het
Ngef T A 1: 87,477,648 N680I probably damaging Het
Nop2 A G 6: 125,144,565 H770R probably benign Het
Pcdhgc3 A G 18: 37,807,676 T377A possibly damaging Het
Prl7b1 T C 13: 27,604,546 K109E probably benign Het
Ptprk C T 10: 28,475,170 T553I probably damaging Het
Rab3d T C 9: 21,910,519 T209A probably benign Het
Ralgapa1 A G 12: 55,757,924 probably null Het
Rspry1 T C 8: 94,622,987 M1T probably null Het
Sec13 G T 6: 113,730,832 P176T probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc4a7 C A 14: 14,739,836 T236K probably benign Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Syt2 A G 1: 134,747,557 N382S probably benign Het
Ubr4 T G 4: 139,421,238 C1678G probably damaging Het
Urb1 A G 16: 90,803,332 S188P probably benign Het
Vmn2r82 A G 10: 79,385,376 S524G probably damaging Het
Wdr19 A G 5: 65,221,713 N233S probably benign Het
Other mutations in Tm7sf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02292:Tm7sf2 APN 19 6063568 missense probably damaging 1.00
IGL03299:Tm7sf2 APN 19 6062928 missense probably benign 0.03
PIT4791001:Tm7sf2 UTSW 19 6063605 missense probably benign 0.00
R0033:Tm7sf2 UTSW 19 6066422 splice site probably benign
R0033:Tm7sf2 UTSW 19 6066422 splice site probably benign
R1607:Tm7sf2 UTSW 19 6063019 unclassified probably null
R3415:Tm7sf2 UTSW 19 6063599 missense probably damaging 1.00
R5392:Tm7sf2 UTSW 19 6063968 missense probably damaging 1.00
R5835:Tm7sf2 UTSW 19 6063884 missense probably damaging 1.00
R5886:Tm7sf2 UTSW 19 6066542 unclassified probably benign
R6300:Tm7sf2 UTSW 19 6067200 missense probably damaging 1.00
R6915:Tm7sf2 UTSW 19 6068312 missense probably damaging 0.99
R7037:Tm7sf2 UTSW 19 6064077 critical splice donor site probably null
R7073:Tm7sf2 UTSW 19 6066497 critical splice donor site probably null
R7328:Tm7sf2 UTSW 19 6064126 missense possibly damaging 0.63
R7373:Tm7sf2 UTSW 19 6066646 missense probably benign 0.39
R7612:Tm7sf2 UTSW 19 6070608 missense probably benign 0.08
R7779:Tm7sf2 UTSW 19 6062917 missense possibly damaging 0.95
R7903:Tm7sf2 UTSW 19 6071335 missense probably damaging 1.00
R7904:Tm7sf2 UTSW 19 6068912 missense probably damaging 0.96
R7986:Tm7sf2 UTSW 19 6071335 missense probably damaging 1.00
R7987:Tm7sf2 UTSW 19 6068912 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGCACTAGCACCCATTTC -3'
(R):5'- GGTTACTACATCTTCCGAGGGG -3'

Posted On2017-07-14