Incidental Mutation 'R6066:Cul3'
ID484029
Institutional Source Beutler Lab
Gene Symbol Cul3
Ensembl Gene ENSMUSG00000004364
Gene Namecullin 3
Synonyms
MMRRC Submission 044230-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6066 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location80264923-80340480 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80283759 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 250 (C250S)
Ref Sequence ENSEMBL: ENSMUSP00000131891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163119] [ENSMUST00000164108]
Predicted Effect probably benign
Transcript: ENSMUST00000163119
AA Change: C316S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000130738
Gene: ENSMUSG00000004364
AA Change: C316S

DomainStartEndE-ValueType
PDB:4AP2|B 1 389 N/A PDB
SCOP:d1ldja2 30 382 1e-117 SMART
Blast:CULLIN 258 295 2e-15 BLAST
CULLIN 413 563 1.98e-90 SMART
Cullin_Nedd8 695 762 1.49e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164108
AA Change: C250S

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000131891
Gene: ENSMUSG00000004364
AA Change: C250S

DomainStartEndE-ValueType
SCOP:d1ldja2 23 316 1e-101 SMART
PDB:4APF|B 23 323 N/A PDB
Blast:CULLIN 192 229 1e-15 BLAST
CULLIN 347 497 1.98e-90 SMART
Cullin_Nedd8 629 696 1.49e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170897
SMART Domains Protein: ENSMUSP00000130010
Gene: ENSMUSG00000004364

DomainStartEndE-ValueType
PDB:4AP2|B 2 45 1e-24 PDB
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cullin protein family. The encoded protein plays a critical role in the polyubiquitination and subsequent degradation of specific protein substrates as the core component and scaffold protein of an E3 ubiquitin ligase complex. Complexes including the encoded protein may also play a role in late endosome maturation. Mutations in this gene are a cause of type 2E pseudohypoaldosteronism. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for a targeted null mutation accumulate cyclin E, exhibit abnormal cycling in cells of extraembryonic ectoderm and trophectoderm, reduced size, abnormal gastrulation and trophoblast cells, absence of an amnion, and death by embryonic day 7.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrb1 T C 15: 74,540,459 F429S probably damaging Het
Ahi1 A T 10: 20,959,926 M53L possibly damaging Het
Ahr A T 12: 35,504,921 F400I probably damaging Het
Ak7 G T 12: 105,733,491 G223V possibly damaging Het
Alpk3 A G 7: 81,076,950 I128V possibly damaging Het
Ampd3 A T 7: 110,793,767 E247D probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Arhgef10l A G 4: 140,577,080 F243L probably damaging Het
Cdh23 A T 10: 60,433,758 V661E probably damaging Het
Cox8c A G 12: 102,900,275 T53A probably benign Het
Creld2 C A 15: 88,823,766 T236K possibly damaging Het
Dhx37 A C 5: 125,424,666 F510V probably benign Het
Fblim1 T C 4: 141,577,909 D350G probably damaging Het
Lipm A G 19: 34,112,974 Y185C probably damaging Het
Mfsd4b4 A G 10: 39,892,053 F348S probably benign Het
Misp A G 10: 79,826,312 R188G possibly damaging Het
Nbeal1 T G 1: 60,248,405 I936S probably benign Het
Ngly1 G A 14: 16,294,634 M521I probably benign Het
Nlrp9a A T 7: 26,558,085 Y376F probably benign Het
Oas3 T C 5: 120,772,924 K197R probably damaging Het
Pars2 T C 4: 106,654,079 Y353H probably damaging Het
Pik3r1 T C 13: 101,686,320 N625D possibly damaging Het
Pkhd1l1 T A 15: 44,528,129 S1530R probably damaging Het
Rsph6a C T 7: 19,065,815 P457L probably damaging Het
Secisbp2 T C 13: 51,677,222 S565P probably benign Het
Slc28a3 T C 13: 58,578,487 M163V probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Szt2 T C 4: 118,371,974 T2890A unknown Het
Tatdn3 A T 1: 191,046,268 V242E probably benign Het
Vmn1r22 T G 6: 57,900,879 M38L probably benign Het
Vmn2r104 A G 17: 20,038,311 F524L possibly damaging Het
Vmn2r94 A G 17: 18,257,433 S239P probably damaging Het
Xpo7 T C 14: 70,682,338 D679G probably null Het
Zbtb42 C A 12: 112,679,607 T72K probably damaging Het
Zfp493 G A 13: 67,786,950 A341T possibly damaging Het
Zfp811 A G 17: 32,798,827 C80R possibly damaging Het
Other mutations in Cul3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Cul3 APN 1 80288740 splice site probably benign
IGL01454:Cul3 APN 1 80304183 missense probably damaging 0.97
IGL01510:Cul3 APN 1 80282679 missense probably damaging 1.00
IGL01701:Cul3 APN 1 80277423 missense probably damaging 0.97
IGL02117:Cul3 APN 1 80323064 splice site probably benign
IGL02194:Cul3 APN 1 80323037 missense probably benign 0.03
IGL02217:Cul3 APN 1 80283767 missense probably damaging 0.97
IGL02417:Cul3 APN 1 80322902 missense probably damaging 1.00
IGL02445:Cul3 APN 1 80304169 missense possibly damaging 0.74
IGL02601:Cul3 APN 1 80271715 intron probably benign
IGL03201:Cul3 APN 1 80281427 missense probably damaging 1.00
R0467:Cul3 UTSW 1 80280863 missense probably benign 0.01
R0662:Cul3 UTSW 1 80271565 missense probably damaging 1.00
R0688:Cul3 UTSW 1 80271564 missense possibly damaging 0.63
R0761:Cul3 UTSW 1 80277486 unclassified probably benign
R0924:Cul3 UTSW 1 80290118 missense probably damaging 0.99
R0930:Cul3 UTSW 1 80290118 missense probably damaging 0.99
R0940:Cul3 UTSW 1 80322847 intron probably benign
R1117:Cul3 UTSW 1 80280924 missense probably damaging 1.00
R1572:Cul3 UTSW 1 80282789 missense possibly damaging 0.91
R2384:Cul3 UTSW 1 80283689 missense probably damaging 0.99
R3894:Cul3 UTSW 1 80283690 missense probably damaging 0.97
R4676:Cul3 UTSW 1 80271674 missense probably damaging 1.00
R4893:Cul3 UTSW 1 80288850 missense probably damaging 0.98
R4908:Cul3 UTSW 1 80280915 missense possibly damaging 0.91
R4910:Cul3 UTSW 1 80290089 missense probably benign 0.09
R5173:Cul3 UTSW 1 80281416 missense possibly damaging 0.94
R5787:Cul3 UTSW 1 80282721 missense probably benign 0.13
R5887:Cul3 UTSW 1 80276422 missense possibly damaging 0.94
R6057:Cul3 UTSW 1 80271532 missense probably damaging 1.00
R6279:Cul3 UTSW 1 80286952 missense probably damaging 0.98
R6300:Cul3 UTSW 1 80286952 missense probably damaging 0.98
R6617:Cul3 UTSW 1 80276439 missense probably damaging 1.00
R7059:Cul3 UTSW 1 80276424 missense probably benign 0.00
R7223:Cul3 UTSW 1 80287000 missense probably benign 0.14
R7774:Cul3 UTSW 1 80269294 missense probably benign
Z1088:Cul3 UTSW 1 80290091 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TTTAGCTCCCTGACGCATATGTG -3'
(R):5'- GCTGTAACTTTTCAACTAACGCTC -3'

Sequencing Primer
(F):5'- CTCCCTGACGCATATGTGGATATG -3'
(R):5'- CGCTCATTTATAGTTATGTGGACAGC -3'
Posted On2017-07-14