Incidental Mutation 'R6066:Tatdn3'
ID484030
Institutional Source Beutler Lab
Gene Symbol Tatdn3
Ensembl Gene ENSMUSG00000026632
Gene NameTatD DNase domain containing 3
Synonyms
MMRRC Submission 044230-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6066 (G1)
Quality Score213.009
Status Not validated
Chromosome1
Chromosomal Location191045826-191062932 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 191046268 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 242 (V242E)
Ref Sequence ENSEMBL: ENSMUSP00000106518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027945] [ENSMUST00000077889] [ENSMUST00000085633] [ENSMUST00000110891] [ENSMUST00000110893] [ENSMUST00000192151]
Predicted Effect probably benign
Transcript: ENSMUST00000027945
AA Change: V241E

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027945
Gene: ENSMUSG00000026632
AA Change: V241E

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 263 5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077889
Predicted Effect probably benign
Transcript: ENSMUST00000085633
SMART Domains Protein: ENSMUSP00000082773
Gene: ENSMUSG00000026632

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 170 1.1e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110891
SMART Domains Protein: ENSMUSP00000106516
Gene: ENSMUSG00000026632

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 231 2.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110893
AA Change: V242E

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000106518
Gene: ENSMUSG00000026632
AA Change: V242E

DomainStartEndE-ValueType
Pfam:TatD_DNase 6 264 1.8e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156341
Predicted Effect probably benign
Transcript: ENSMUST00000192151
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrb1 T C 15: 74,540,459 F429S probably damaging Het
Ahi1 A T 10: 20,959,926 M53L possibly damaging Het
Ahr A T 12: 35,504,921 F400I probably damaging Het
Ak7 G T 12: 105,733,491 G223V possibly damaging Het
Alpk3 A G 7: 81,076,950 I128V possibly damaging Het
Ampd3 A T 7: 110,793,767 E247D probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Arhgef10l A G 4: 140,577,080 F243L probably damaging Het
Cdh23 A T 10: 60,433,758 V661E probably damaging Het
Cox8c A G 12: 102,900,275 T53A probably benign Het
Creld2 C A 15: 88,823,766 T236K possibly damaging Het
Cul3 A T 1: 80,283,759 C250S probably benign Het
Dhx37 A C 5: 125,424,666 F510V probably benign Het
Fblim1 T C 4: 141,577,909 D350G probably damaging Het
Lipm A G 19: 34,112,974 Y185C probably damaging Het
Mfsd4b4 A G 10: 39,892,053 F348S probably benign Het
Misp A G 10: 79,826,312 R188G possibly damaging Het
Nbeal1 T G 1: 60,248,405 I936S probably benign Het
Ngly1 G A 14: 16,294,634 M521I probably benign Het
Nlrp9a A T 7: 26,558,085 Y376F probably benign Het
Oas3 T C 5: 120,772,924 K197R probably damaging Het
Pars2 T C 4: 106,654,079 Y353H probably damaging Het
Pik3r1 T C 13: 101,686,320 N625D possibly damaging Het
Pkhd1l1 T A 15: 44,528,129 S1530R probably damaging Het
Rsph6a C T 7: 19,065,815 P457L probably damaging Het
Secisbp2 T C 13: 51,677,222 S565P probably benign Het
Slc28a3 T C 13: 58,578,487 M163V probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Szt2 T C 4: 118,371,974 T2890A unknown Het
Vmn1r22 T G 6: 57,900,879 M38L probably benign Het
Vmn2r104 A G 17: 20,038,311 F524L possibly damaging Het
Vmn2r94 A G 17: 18,257,433 S239P probably damaging Het
Xpo7 T C 14: 70,682,338 D679G probably null Het
Zbtb42 C A 12: 112,679,607 T72K probably damaging Het
Zfp493 G A 13: 67,786,950 A341T possibly damaging Het
Zfp811 A G 17: 32,798,827 C80R possibly damaging Het
Other mutations in Tatdn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Tatdn3 APN 1 191055381 splice site probably benign
IGL02819:Tatdn3 APN 1 191055344 missense probably benign 0.04
IGL02898:Tatdn3 APN 1 191046310 makesense probably null
R0718:Tatdn3 UTSW 1 191052849 splice site probably benign
R0892:Tatdn3 UTSW 1 191062805 missense probably benign 0.22
R1635:Tatdn3 UTSW 1 191060176 missense probably benign
R2018:Tatdn3 UTSW 1 191049280 critical splice donor site probably null
R2088:Tatdn3 UTSW 1 191052876 missense possibly damaging 0.59
R2243:Tatdn3 UTSW 1 191052900 missense probably damaging 1.00
R3933:Tatdn3 UTSW 1 191046324 splice site probably null
R4676:Tatdn3 UTSW 1 191049334 missense probably damaging 1.00
R5047:Tatdn3 UTSW 1 191046278 missense probably damaging 1.00
R5923:Tatdn3 UTSW 1 191049310 missense probably damaging 1.00
R6044:Tatdn3 UTSW 1 191056361 critical splice donor site probably null
R7770:Tatdn3 UTSW 1 191058856 missense probably benign 0.05
R8331:Tatdn3 UTSW 1 191046211 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGGCCACTAAAGCAAGCC -3'
(R):5'- GCCCATACCTGCCAAGTTCATC -3'

Sequencing Primer
(F):5'- CCTTGCTTTCCCCAGCG -3'
(R):5'- GGAATGTCAGCTCCTTCATAGAG -3'
Posted On2017-07-14