Incidental Mutation 'R6066:Szt2'
ID484032
Institutional Source Beutler Lab
Gene Symbol Szt2
Ensembl Gene ENSMUSG00000033253
Gene Nameseizure threshold 2
Synonyms
MMRRC Submission 044230-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.806) question?
Stock #R6066 (G1)
Quality Score180.009
Status Not validated
Chromosome4
Chromosomal Location118362743-118409273 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118371974 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 2890 (T2890A)
Ref Sequence ENSEMBL: ENSMUSP00000074862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075406]
Predicted Effect unknown
Transcript: ENSMUST00000075406
AA Change: T2890A
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: T2890A

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138386
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138632
Predicted Effect unknown
Transcript: ENSMUST00000183402
AA Change: T421A
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrb1 T C 15: 74,540,459 F429S probably damaging Het
Ahi1 A T 10: 20,959,926 M53L possibly damaging Het
Ahr A T 12: 35,504,921 F400I probably damaging Het
Ak7 G T 12: 105,733,491 G223V possibly damaging Het
Alpk3 A G 7: 81,076,950 I128V possibly damaging Het
Ampd3 A T 7: 110,793,767 E247D probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Arhgef10l A G 4: 140,577,080 F243L probably damaging Het
Cdh23 A T 10: 60,433,758 V661E probably damaging Het
Cox8c A G 12: 102,900,275 T53A probably benign Het
Creld2 C A 15: 88,823,766 T236K possibly damaging Het
Cul3 A T 1: 80,283,759 C250S probably benign Het
Dhx37 A C 5: 125,424,666 F510V probably benign Het
Fblim1 T C 4: 141,577,909 D350G probably damaging Het
Lipm A G 19: 34,112,974 Y185C probably damaging Het
Mfsd4b4 A G 10: 39,892,053 F348S probably benign Het
Misp A G 10: 79,826,312 R188G possibly damaging Het
Nbeal1 T G 1: 60,248,405 I936S probably benign Het
Ngly1 G A 14: 16,294,634 M521I probably benign Het
Nlrp9a A T 7: 26,558,085 Y376F probably benign Het
Oas3 T C 5: 120,772,924 K197R probably damaging Het
Pars2 T C 4: 106,654,079 Y353H probably damaging Het
Pik3r1 T C 13: 101,686,320 N625D possibly damaging Het
Pkhd1l1 T A 15: 44,528,129 S1530R probably damaging Het
Rsph6a C T 7: 19,065,815 P457L probably damaging Het
Secisbp2 T C 13: 51,677,222 S565P probably benign Het
Slc28a3 T C 13: 58,578,487 M163V probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Tatdn3 A T 1: 191,046,268 V242E probably benign Het
Vmn1r22 T G 6: 57,900,879 M38L probably benign Het
Vmn2r104 A G 17: 20,038,311 F524L possibly damaging Het
Vmn2r94 A G 17: 18,257,433 S239P probably damaging Het
Xpo7 T C 14: 70,682,338 D679G probably null Het
Zbtb42 C A 12: 112,679,607 T72K probably damaging Het
Zfp493 G A 13: 67,786,950 A341T possibly damaging Het
Zfp811 A G 17: 32,798,827 C80R possibly damaging Het
Other mutations in Szt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Szt2 APN 4 118384250 splice site probably benign
IGL01082:Szt2 APN 4 118397624 missense probably damaging 1.00
IGL01348:Szt2 APN 4 118393624 splice site probably benign
IGL01869:Szt2 APN 4 118399071 missense possibly damaging 0.87
IGL01918:Szt2 APN 4 118384253 splice site probably benign
IGL01951:Szt2 APN 4 118376493 unclassified probably benign
IGL01971:Szt2 APN 4 118386955 missense probably benign 0.01
IGL02047:Szt2 APN 4 118376637 unclassified probably benign
IGL02092:Szt2 APN 4 118363332 unclassified probably benign
IGL02120:Szt2 APN 4 118388564 missense probably benign 0.01
IGL02210:Szt2 APN 4 118389823 missense possibly damaging 0.95
IGL02435:Szt2 APN 4 118390823 missense probably damaging 1.00
IGL02622:Szt2 APN 4 118392890 missense probably damaging 0.96
IGL02666:Szt2 APN 4 118374055 missense probably damaging 0.99
IGL02712:Szt2 APN 4 118384833 missense probably benign 0.19
IGL02983:Szt2 APN 4 118365779 unclassified probably benign
IGL03026:Szt2 APN 4 118391849 missense probably benign 0.40
IGL03178:Szt2 APN 4 118382689 missense unknown
IGL03233:Szt2 APN 4 118372529 missense unknown
IGL03377:Szt2 APN 4 118402397 splice site probably benign
IGL03387:Szt2 APN 4 118364725 unclassified probably benign
PIT4687001:Szt2 UTSW 4 118398201 missense possibly damaging 0.84
R0026:Szt2 UTSW 4 118384772 missense possibly damaging 0.92
R0352:Szt2 UTSW 4 118382593 missense unknown
R0396:Szt2 UTSW 4 118376347 unclassified probably benign
R0504:Szt2 UTSW 4 118372952 splice site probably null
R1033:Szt2 UTSW 4 118387106 missense probably damaging 0.98
R1222:Szt2 UTSW 4 118405459 missense possibly damaging 0.77
R1418:Szt2 UTSW 4 118387779 missense probably benign 0.03
R1462:Szt2 UTSW 4 118373967 missense unknown
R1462:Szt2 UTSW 4 118373967 missense unknown
R1763:Szt2 UTSW 4 118372368 missense unknown
R1772:Szt2 UTSW 4 118405517 missense probably damaging 1.00
R1840:Szt2 UTSW 4 118365657 unclassified probably benign
R1942:Szt2 UTSW 4 118392620 missense probably benign 0.17
R1965:Szt2 UTSW 4 118383965 missense probably benign 0.36
R1998:Szt2 UTSW 4 118375727 critical splice donor site probably null
R2009:Szt2 UTSW 4 118378064 critical splice donor site probably null
R2012:Szt2 UTSW 4 118363665 unclassified probably benign
R2044:Szt2 UTSW 4 118376448 nonsense probably null
R2066:Szt2 UTSW 4 118373980 missense unknown
R2345:Szt2 UTSW 4 118381397 missense unknown
R2857:Szt2 UTSW 4 118369402 missense probably damaging 1.00
R3156:Szt2 UTSW 4 118402819 critical splice donor site probably null
R3236:Szt2 UTSW 4 118383034 splice site probably null
R3237:Szt2 UTSW 4 118383034 splice site probably null
R3405:Szt2 UTSW 4 118394020 missense probably benign 0.02
R3795:Szt2 UTSW 4 118391730 missense probably damaging 1.00
R3878:Szt2 UTSW 4 118390585 missense probably damaging 1.00
R3906:Szt2 UTSW 4 118378269 unclassified probably benign
R4012:Szt2 UTSW 4 118383900 missense probably benign 0.02
R4039:Szt2 UTSW 4 118364952 unclassified probably benign
R4081:Szt2 UTSW 4 118373567 splice site probably benign
R4298:Szt2 UTSW 4 118365406 unclassified probably benign
R4299:Szt2 UTSW 4 118365406 unclassified probably benign
R4432:Szt2 UTSW 4 118384231 missense probably damaging 0.99
R4597:Szt2 UTSW 4 118372681 missense unknown
R4657:Szt2 UTSW 4 118397669 missense probably benign 0.06
R4663:Szt2 UTSW 4 118377684 unclassified probably benign
R4670:Szt2 UTSW 4 118375829 unclassified probably benign
R4704:Szt2 UTSW 4 118393829 missense probably damaging 0.99
R4748:Szt2 UTSW 4 118389191 nonsense probably null
R4786:Szt2 UTSW 4 118399062 missense probably benign 0.20
R4809:Szt2 UTSW 4 118388985 missense probably damaging 1.00
R4830:Szt2 UTSW 4 118369248 missense unknown
R4944:Szt2 UTSW 4 118388669 missense probably benign 0.03
R5077:Szt2 UTSW 4 118369616 critical splice donor site probably null
R5121:Szt2 UTSW 4 118385444 missense possibly damaging 0.92
R5140:Szt2 UTSW 4 118386981 missense possibly damaging 0.46
R5169:Szt2 UTSW 4 118389830 missense probably benign 0.26
R5198:Szt2 UTSW 4 118388322 missense probably benign 0.03
R5433:Szt2 UTSW 4 118375466 unclassified probably benign
R5625:Szt2 UTSW 4 118373217 missense unknown
R5628:Szt2 UTSW 4 118373217 missense unknown
R5630:Szt2 UTSW 4 118392905 missense possibly damaging 0.83
R5808:Szt2 UTSW 4 118372613 missense unknown
R5902:Szt2 UTSW 4 118391503 missense probably benign 0.05
R6049:Szt2 UTSW 4 118402988 missense probably damaging 0.99
R6272:Szt2 UTSW 4 118374290 unclassified probably benign
R6456:Szt2 UTSW 4 118376697 unclassified probably benign
R6538:Szt2 UTSW 4 118390477 splice site probably null
R6604:Szt2 UTSW 4 118385474 missense probably benign 0.01
R6664:Szt2 UTSW 4 118391745 missense probably damaging 1.00
R6834:Szt2 UTSW 4 118388325 missense probably benign 0.01
R7109:Szt2 UTSW 4 118375479 missense unknown
R7163:Szt2 UTSW 4 118405530 missense possibly damaging 0.90
R7190:Szt2 UTSW 4 118389006 missense probably damaging 0.98
R7289:Szt2 UTSW 4 118375878 missense unknown
R7291:Szt2 UTSW 4 118391249 missense probably damaging 0.98
R7383:Szt2 UTSW 4 118365214 nonsense probably null
R7448:Szt2 UTSW 4 118363471 missense unknown
R7637:Szt2 UTSW 4 118393828 missense probably damaging 0.99
R7833:Szt2 UTSW 4 118366219 missense unknown
R7896:Szt2 UTSW 4 118402913 missense possibly damaging 0.62
R7916:Szt2 UTSW 4 118366219 missense unknown
R7979:Szt2 UTSW 4 118402913 missense possibly damaging 0.62
X0023:Szt2 UTSW 4 118372404 missense unknown
Z1176:Szt2 UTSW 4 118393976 missense probably damaging 0.99
Z1177:Szt2 UTSW 4 118391214 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATGCACAATGCCTCGG -3'
(R):5'- GACTTGTGCACCCTCTGAAG -3'

Sequencing Primer
(F):5'- CCTGGTCTACAAAGTGAGTTCCAG -3'
(R):5'- CCTCTGAAGGGCAGGTGAG -3'
Posted On2017-07-14