Incidental Mutation 'R6066:Slc35e2'
ID484035
Institutional Source Beutler Lab
Gene Symbol Slc35e2
Ensembl Gene ENSMUSG00000042202
Gene Namesolute carrier family 35, member E2
Synonyms
MMRRC Submission 044230-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6066 (G1)
Quality Score211.009
Status Not validated
Chromosome4
Chromosomal Location155601416-155623340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 155610026 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 10 (P10L)
Ref Sequence ENSEMBL: ENSMUSP00000113189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043829] [ENSMUST00000105608] [ENSMUST00000115821] [ENSMUST00000118607]
Predicted Effect probably benign
Transcript: ENSMUST00000043829
AA Change: P10L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041449
Gene: ENSMUSG00000042202
AA Change: P10L

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
Pfam:TPT 73 368 7.9e-93 PFAM
Pfam:UAA 74 371 1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105608
AA Change: P10L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101233
Gene: ENSMUSG00000042202
AA Change: P10L

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
Pfam:UAA 75 375 6.9e-10 PFAM
Pfam:EamA 84 215 5.8e-8 PFAM
Pfam:TPT 224 369 3.8e-34 PFAM
Pfam:EamA 237 369 3.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115821
SMART Domains Protein: ENSMUSP00000111488
Gene: ENSMUSG00000073682

DomainStartEndE-ValueType
SCOP:d1l9ha_ 17 52 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118607
AA Change: P10L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113189
Gene: ENSMUSG00000042202
AA Change: P10L

DomainStartEndE-ValueType
low complexity region 10 21 N/A INTRINSIC
low complexity region 50 66 N/A INTRINSIC
Pfam:UAA 75 375 6.9e-10 PFAM
Pfam:EamA 84 215 5.8e-8 PFAM
Pfam:TPT 224 369 3.8e-34 PFAM
Pfam:EamA 237 369 3.4e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151425
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrb1 T C 15: 74,540,459 F429S probably damaging Het
Ahi1 A T 10: 20,959,926 M53L possibly damaging Het
Ahr A T 12: 35,504,921 F400I probably damaging Het
Ak7 G T 12: 105,733,491 G223V possibly damaging Het
Alpk3 A G 7: 81,076,950 I128V possibly damaging Het
Ampd3 A T 7: 110,793,767 E247D probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Arhgef10l A G 4: 140,577,080 F243L probably damaging Het
Cdh23 A T 10: 60,433,758 V661E probably damaging Het
Cox8c A G 12: 102,900,275 T53A probably benign Het
Creld2 C A 15: 88,823,766 T236K possibly damaging Het
Cul3 A T 1: 80,283,759 C250S probably benign Het
Dhx37 A C 5: 125,424,666 F510V probably benign Het
Fblim1 T C 4: 141,577,909 D350G probably damaging Het
Lipm A G 19: 34,112,974 Y185C probably damaging Het
Mfsd4b4 A G 10: 39,892,053 F348S probably benign Het
Misp A G 10: 79,826,312 R188G possibly damaging Het
Nbeal1 T G 1: 60,248,405 I936S probably benign Het
Ngly1 G A 14: 16,294,634 M521I probably benign Het
Nlrp9a A T 7: 26,558,085 Y376F probably benign Het
Oas3 T C 5: 120,772,924 K197R probably damaging Het
Pars2 T C 4: 106,654,079 Y353H probably damaging Het
Pik3r1 T C 13: 101,686,320 N625D possibly damaging Het
Pkhd1l1 T A 15: 44,528,129 S1530R probably damaging Het
Rsph6a C T 7: 19,065,815 P457L probably damaging Het
Secisbp2 T C 13: 51,677,222 S565P probably benign Het
Slc28a3 T C 13: 58,578,487 M163V probably benign Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Szt2 T C 4: 118,371,974 T2890A unknown Het
Tatdn3 A T 1: 191,046,268 V242E probably benign Het
Vmn1r22 T G 6: 57,900,879 M38L probably benign Het
Vmn2r104 A G 17: 20,038,311 F524L possibly damaging Het
Vmn2r94 A G 17: 18,257,433 S239P probably damaging Het
Xpo7 T C 14: 70,682,338 D679G probably null Het
Zbtb42 C A 12: 112,679,607 T72K probably damaging Het
Zfp493 G A 13: 67,786,950 A341T possibly damaging Het
Zfp811 A G 17: 32,798,827 C80R possibly damaging Het
Other mutations in Slc35e2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01919:Slc35e2 APN 4 155612730 missense probably benign
IGL02244:Slc35e2 APN 4 155618562 missense probably damaging 0.97
R1774:Slc35e2 UTSW 4 155610164 missense possibly damaging 0.51
R1856:Slc35e2 UTSW 4 155611729 missense probably damaging 1.00
R4600:Slc35e2 UTSW 4 155617649 missense probably benign 0.04
R4601:Slc35e2 UTSW 4 155617649 missense probably benign 0.04
R4603:Slc35e2 UTSW 4 155617649 missense probably benign 0.04
R4610:Slc35e2 UTSW 4 155617649 missense probably benign 0.04
R4917:Slc35e2 UTSW 4 155616236 missense probably damaging 1.00
R4918:Slc35e2 UTSW 4 155616236 missense probably damaging 1.00
R5440:Slc35e2 UTSW 4 155610026 missense probably benign
R5468:Slc35e2 UTSW 4 155610026 missense probably benign
R5469:Slc35e2 UTSW 4 155610026 missense probably benign
R5470:Slc35e2 UTSW 4 155610026 missense probably benign
R5512:Slc35e2 UTSW 4 155610026 missense probably benign
R5513:Slc35e2 UTSW 4 155610026 missense probably benign
R5514:Slc35e2 UTSW 4 155610026 missense probably benign
R5689:Slc35e2 UTSW 4 155610026 missense probably benign
R5692:Slc35e2 UTSW 4 155610026 missense probably benign
R5711:Slc35e2 UTSW 4 155610026 missense probably benign
R5714:Slc35e2 UTSW 4 155610026 missense probably benign
R5799:Slc35e2 UTSW 4 155610026 missense probably benign
R5872:Slc35e2 UTSW 4 155612680 missense probably damaging 1.00
R5925:Slc35e2 UTSW 4 155611627 missense probably damaging 1.00
R5947:Slc35e2 UTSW 4 155611714 missense possibly damaging 0.70
R6044:Slc35e2 UTSW 4 155610026 missense probably benign
R6063:Slc35e2 UTSW 4 155610026 missense probably benign
R6065:Slc35e2 UTSW 4 155610026 missense probably benign
R6188:Slc35e2 UTSW 4 155610026 missense probably benign
R6243:Slc35e2 UTSW 4 155610026 missense probably benign
R6273:Slc35e2 UTSW 4 155610026 missense probably benign
R6484:Slc35e2 UTSW 4 155612647 missense probably damaging 0.99
R6867:Slc35e2 UTSW 4 155618700 missense probably benign 0.00
R7143:Slc35e2 UTSW 4 155618594 missense probably benign 0.01
R7384:Slc35e2 UTSW 4 155610632 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCTCCACATATGTCTGCAC -3'
(R):5'- CCGACTCAATGACAGTGGTCTC -3'

Sequencing Primer
(F):5'- CAGGTGTCAAATGCATCTTACACAGG -3'
(R):5'- ACTCAATGACAGTGGTCTCTGTGATG -3'
Posted On2017-07-14