Incidental Mutation 'R6066:Vmn1r22'
ID484038
Institutional Source Beutler Lab
Gene Symbol Vmn1r22
Ensembl Gene ENSMUSG00000115091
Gene Namevomeronasal 1 receptor 22
SynonymsV1rc23
MMRRC Submission 044230-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R6066 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location57898126-57908028 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 57900879 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 38 (M38L)
Ref Sequence ENSEMBL: ENSMUSP00000154301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177435] [ENSMUST00000227342] [ENSMUST00000227650] [ENSMUST00000228076] [ENSMUST00000228257] [ENSMUST00000228322] [ENSMUST00000228905]
Predicted Effect probably benign
Transcript: ENSMUST00000177435
AA Change: M38L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000135207
Gene: ENSMUSG00000114982
AA Change: M38L

DomainStartEndE-ValueType
Pfam:V1R 28 293 3.9e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000227342
Predicted Effect probably benign
Transcript: ENSMUST00000227650
AA Change: M38L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000228076
AA Change: M38L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000228257
AA Change: M38L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000228322
AA Change: M38L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000228905
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrb1 T C 15: 74,540,459 F429S probably damaging Het
Ahi1 A T 10: 20,959,926 M53L possibly damaging Het
Ahr A T 12: 35,504,921 F400I probably damaging Het
Ak7 G T 12: 105,733,491 G223V possibly damaging Het
Alpk3 A G 7: 81,076,950 I128V possibly damaging Het
Ampd3 A T 7: 110,793,767 E247D probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Arhgef10l A G 4: 140,577,080 F243L probably damaging Het
Cdh23 A T 10: 60,433,758 V661E probably damaging Het
Cox8c A G 12: 102,900,275 T53A probably benign Het
Creld2 C A 15: 88,823,766 T236K possibly damaging Het
Cul3 A T 1: 80,283,759 C250S probably benign Het
Dhx37 A C 5: 125,424,666 F510V probably benign Het
Fblim1 T C 4: 141,577,909 D350G probably damaging Het
Lipm A G 19: 34,112,974 Y185C probably damaging Het
Mfsd4b4 A G 10: 39,892,053 F348S probably benign Het
Misp A G 10: 79,826,312 R188G possibly damaging Het
Nbeal1 T G 1: 60,248,405 I936S probably benign Het
Ngly1 G A 14: 16,294,634 M521I probably benign Het
Nlrp9a A T 7: 26,558,085 Y376F probably benign Het
Oas3 T C 5: 120,772,924 K197R probably damaging Het
Pars2 T C 4: 106,654,079 Y353H probably damaging Het
Pik3r1 T C 13: 101,686,320 N625D possibly damaging Het
Pkhd1l1 T A 15: 44,528,129 S1530R probably damaging Het
Rsph6a C T 7: 19,065,815 P457L probably damaging Het
Secisbp2 T C 13: 51,677,222 S565P probably benign Het
Slc28a3 T C 13: 58,578,487 M163V probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Szt2 T C 4: 118,371,974 T2890A unknown Het
Tatdn3 A T 1: 191,046,268 V242E probably benign Het
Vmn2r104 A G 17: 20,038,311 F524L possibly damaging Het
Vmn2r94 A G 17: 18,257,433 S239P probably damaging Het
Xpo7 T C 14: 70,682,338 D679G probably null Het
Zbtb42 C A 12: 112,679,607 T72K probably damaging Het
Zfp493 G A 13: 67,786,950 A341T possibly damaging Het
Zfp811 A G 17: 32,798,827 C80R possibly damaging Het
Other mutations in Vmn1r22
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0089:Vmn1r22 UTSW 6 57900528 missense probably benign 0.06
R0415:Vmn1r22 UTSW 6 57900332 missense probably benign 0.18
R1132:Vmn1r22 UTSW 6 57900841 missense probably benign 0.43
R1609:Vmn1r22 UTSW 6 57900748 nonsense probably null
R1666:Vmn1r22 UTSW 6 57900719 missense probably benign 0.07
R1668:Vmn1r22 UTSW 6 57900719 missense probably benign 0.07
R1708:Vmn1r22 UTSW 6 57900496 missense possibly damaging 0.46
R1796:Vmn1r22 UTSW 6 57900149 missense probably damaging 1.00
R2359:Vmn1r22 UTSW 6 57900989 start codon destroyed probably null 1.00
R4600:Vmn1r22 UTSW 6 57900875 missense probably damaging 1.00
R5302:Vmn1r22 UTSW 6 57900975 missense possibly damaging 0.87
R5560:Vmn1r22 UTSW 6 57900738 missense probably damaging 1.00
R6026:Vmn1r22 UTSW 6 57900405 missense probably benign 0.00
R6343:Vmn1r22 UTSW 6 57900578 missense possibly damaging 0.65
R6639:Vmn1r22 UTSW 6 57900714 missense probably benign 0.01
R7106:Vmn1r22 UTSW 6 57900311 missense probably damaging 1.00
R7683:Vmn1r22 UTSW 6 57900419 missense probably damaging 1.00
R8126:Vmn1r22 UTSW 6 57900684 missense possibly damaging 0.85
S24628:Vmn1r22 UTSW 6 57900332 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- TGTGATGCACATAGAGAGTCC -3'
(R):5'- TTGGAGGGTATATAACAATGTAGGC -3'

Sequencing Primer
(F):5'- GAGTCCTCTCATCACCCTACCAG -3'
(R):5'- ACTGTGAGGTGAATCATAAGTTTG -3'
Posted On2017-07-14