Incidental Mutation 'R6066:Alpk3'
ID 484041
Institutional Source Beutler Lab
Gene Symbol Alpk3
Ensembl Gene ENSMUSG00000038763
Gene Name alpha-kinase 3
Synonyms Midori
MMRRC Submission 044230-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock # R6066 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 81057600-81105612 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 81076950 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 128 (I128V)
Ref Sequence ENSEMBL: ENSMUSP00000102971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107348]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000107348
AA Change: I128V

PolyPhen 2 Score 0.886 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102971
Gene: ENSMUSG00000038763
AA Change: I128V

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
low complexity region 48 62 N/A INTRINSIC
IGc2 89 159 2.78e-11 SMART
low complexity region 183 192 N/A INTRINSIC
low complexity region 400 427 N/A INTRINSIC
low complexity region 514 532 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 958 971 N/A INTRINSIC
low complexity region 1048 1058 N/A INTRINSIC
low complexity region 1076 1087 N/A INTRINSIC
IG_like 1264 1330 5.73e-2 SMART
low complexity region 1350 1359 N/A INTRINSIC
Alpha_kinase 1395 1592 1.17e-44 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene-trappped allele exhibit altered cardiomyocyte architecture and develop a non-progressive cardiomyopathy that presents features of both hypertrophic and dilated forms of cardiomyopathy, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrb1 T C 15: 74,540,459 F429S probably damaging Het
Ahi1 A T 10: 20,959,926 M53L possibly damaging Het
Ahr A T 12: 35,504,921 F400I probably damaging Het
Ak7 G T 12: 105,733,491 G223V possibly damaging Het
Ampd3 A T 7: 110,793,767 E247D probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Arhgef10l A G 4: 140,577,080 F243L probably damaging Het
Cdh23 A T 10: 60,433,758 V661E probably damaging Het
Cox8c A G 12: 102,900,275 T53A probably benign Het
Creld2 C A 15: 88,823,766 T236K possibly damaging Het
Cul3 A T 1: 80,283,759 C250S probably benign Het
Dhx37 A C 5: 125,424,666 F510V probably benign Het
Fblim1 T C 4: 141,577,909 D350G probably damaging Het
Lipm A G 19: 34,112,974 Y185C probably damaging Het
Mfsd4b4 A G 10: 39,892,053 F348S probably benign Het
Misp A G 10: 79,826,312 R188G possibly damaging Het
Nbeal1 T G 1: 60,248,405 I936S probably benign Het
Ngly1 G A 14: 16,294,634 M521I probably benign Het
Nlrp9a A T 7: 26,558,085 Y376F probably benign Het
Oas3 T C 5: 120,772,924 K197R probably damaging Het
Pars2 T C 4: 106,654,079 Y353H probably damaging Het
Pik3r1 T C 13: 101,686,320 N625D possibly damaging Het
Pkhd1l1 T A 15: 44,528,129 S1530R probably damaging Het
Rsph6a C T 7: 19,065,815 P457L probably damaging Het
Secisbp2 T C 13: 51,677,222 S565P probably benign Het
Slc28a3 T C 13: 58,578,487 M163V probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Szt2 T C 4: 118,371,974 T2890A unknown Het
Tatdn3 A T 1: 191,046,268 V242E probably benign Het
Vmn1r22 T G 6: 57,900,879 M38L probably benign Het
Vmn2r104 A G 17: 20,038,311 F524L possibly damaging Het
Vmn2r94 A G 17: 18,257,433 S239P probably damaging Het
Xpo7 T C 14: 70,682,338 D679G probably null Het
Zbtb42 C A 12: 112,679,607 T72K probably damaging Het
Zfp493 G A 13: 67,786,950 A341T possibly damaging Het
Zfp811 A G 17: 32,798,827 C80R possibly damaging Het
Other mutations in Alpk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Alpk3 APN 7 81078009 missense possibly damaging 0.95
IGL00472:Alpk3 APN 7 81095653 splice site probably benign
IGL01732:Alpk3 APN 7 81057642 missense unknown
IGL01750:Alpk3 APN 7 81092282 missense probably damaging 1.00
IGL01812:Alpk3 APN 7 81100202 missense probably damaging 1.00
IGL02224:Alpk3 APN 7 81076868 splice site probably benign
IGL02292:Alpk3 APN 7 81077905 missense possibly damaging 0.46
IGL02340:Alpk3 APN 7 81078507 missense probably benign 0.03
IGL02517:Alpk3 APN 7 81077895 missense probably benign 0.00
IGL02725:Alpk3 APN 7 81093610 missense possibly damaging 0.91
IGL02755:Alpk3 APN 7 81093759 missense possibly damaging 0.71
IGL03035:Alpk3 APN 7 81078604 missense probably benign 0.00
IGL03102:Alpk3 APN 7 81095056 critical splice donor site probably null
IGL03153:Alpk3 APN 7 81093395 missense probably benign 0.00
IGL03255:Alpk3 APN 7 81092562 missense probably benign 0.01
IGL03367:Alpk3 APN 7 81094990 missense probably benign 0.01
FR4304:Alpk3 UTSW 7 81077762 small insertion probably benign
FR4737:Alpk3 UTSW 7 81077762 small insertion probably benign
IGL03097:Alpk3 UTSW 7 81093909 missense probably benign 0.00
R0092:Alpk3 UTSW 7 81092553 missense probably benign
R0254:Alpk3 UTSW 7 81076974 missense probably benign 0.43
R0310:Alpk3 UTSW 7 81078610 missense possibly damaging 0.61
R0325:Alpk3 UTSW 7 81067953 missense possibly damaging 0.58
R0387:Alpk3 UTSW 7 81104227 missense possibly damaging 0.93
R0971:Alpk3 UTSW 7 81092579 missense possibly damaging 0.55
R1078:Alpk3 UTSW 7 81078600 missense probably benign
R1146:Alpk3 UTSW 7 81077595 missense probably damaging 0.99
R1146:Alpk3 UTSW 7 81077595 missense probably damaging 0.99
R1168:Alpk3 UTSW 7 81103357 missense probably damaging 1.00
R1306:Alpk3 UTSW 7 81093873 missense probably damaging 1.00
R1822:Alpk3 UTSW 7 81076931 nonsense probably null
R2173:Alpk3 UTSW 7 81076900 missense probably damaging 1.00
R2350:Alpk3 UTSW 7 81094970 missense probably damaging 1.00
R2414:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R2417:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R2885:Alpk3 UTSW 7 81100192 missense probably damaging 1.00
R3004:Alpk3 UTSW 7 81103355 nonsense probably null
R3796:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3797:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3798:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3799:Alpk3 UTSW 7 81092753 missense probably benign 0.02
R3894:Alpk3 UTSW 7 81078390 missense possibly damaging 0.93
R4395:Alpk3 UTSW 7 81094955 missense probably damaging 1.00
R4761:Alpk3 UTSW 7 81104168 missense probably damaging 0.99
R5505:Alpk3 UTSW 7 81078561 missense possibly damaging 0.87
R5540:Alpk3 UTSW 7 81095436 missense probably damaging 1.00
R5770:Alpk3 UTSW 7 81078562 missense probably benign 0.02
R5941:Alpk3 UTSW 7 81078653 missense probably damaging 1.00
R5964:Alpk3 UTSW 7 81092260 missense possibly damaging 0.88
R6036:Alpk3 UTSW 7 81093257 missense probably benign 0.34
R6036:Alpk3 UTSW 7 81093257 missense probably benign 0.34
R6517:Alpk3 UTSW 7 81078579 missense possibly damaging 0.54
R6578:Alpk3 UTSW 7 81078684 missense probably benign 0.00
R7230:Alpk3 UTSW 7 81093294 missense probably damaging 1.00
R7266:Alpk3 UTSW 7 81092580 missense possibly damaging 0.55
R7271:Alpk3 UTSW 7 81078454 missense possibly damaging 0.92
R7402:Alpk3 UTSW 7 81076912 missense probably benign 0.29
R7411:Alpk3 UTSW 7 81092852 missense probably benign 0.11
R7454:Alpk3 UTSW 7 81078562 missense probably benign 0.02
R7468:Alpk3 UTSW 7 81100998 nonsense probably null
R7940:Alpk3 UTSW 7 81093945 missense probably damaging 1.00
R8157:Alpk3 UTSW 7 81093722 missense probably benign 0.00
R8246:Alpk3 UTSW 7 81092776 missense probably benign 0.00
R8357:Alpk3 UTSW 7 81093318 missense probably damaging 1.00
R8444:Alpk3 UTSW 7 81057720 missense probably benign 0.08
R8457:Alpk3 UTSW 7 81093318 missense probably damaging 1.00
R8775:Alpk3 UTSW 7 81077850 missense probably benign 0.00
R8775-TAIL:Alpk3 UTSW 7 81077850 missense probably benign 0.00
R8794:Alpk3 UTSW 7 81057655 missense unknown
R8982:Alpk3 UTSW 7 81099002 missense probably damaging 1.00
R9259:Alpk3 UTSW 7 81093554 missense probably damaging 1.00
RF034:Alpk3 UTSW 7 81092414 small deletion probably benign
RF057:Alpk3 UTSW 7 81092417 frame shift probably null
X0022:Alpk3 UTSW 7 81093897 missense probably damaging 0.96
Z1176:Alpk3 UTSW 7 81078626 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTTCTGAAGCTGAGCTGAGTG -3'
(R):5'- TAGTAGAGCCCTGCCCTCTAAC -3'

Sequencing Primer
(F):5'- GGAACCGTCCAGTCTCTTCAGAC -3'
(R):5'- TGCCCTCTAACTCCAGAGAG -3'
Posted On 2017-07-14