Incidental Mutation 'R6066:Ampd3'
ID484042
Institutional Source Beutler Lab
Gene Symbol Ampd3
Ensembl Gene ENSMUSG00000005686
Gene Nameadenosine monophosphate deaminase 3
Synonyms
MMRRC Submission 044230-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6066 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location110768206-110812405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110793767 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 247 (E247D)
Ref Sequence ENSEMBL: ENSMUSP00000149655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005829] [ENSMUST00000143786] [ENSMUST00000148292] [ENSMUST00000170374] [ENSMUST00000213373]
Predicted Effect probably benign
Transcript: ENSMUST00000005829
AA Change: E238D

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000005829
Gene: ENSMUSG00000005686
AA Change: E238D

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
Pfam:A_deaminase 309 716 1.5e-139 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106686
Predicted Effect probably benign
Transcript: ENSMUST00000143786
SMART Domains Protein: ENSMUSP00000120983
Gene: ENSMUSG00000005686

DomainStartEndE-ValueType
low complexity region 107 119 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148292
SMART Domains Protein: ENSMUSP00000122657
Gene: ENSMUSG00000005686

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170374
AA Change: E238D

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000130495
Gene: ENSMUSG00000005686
AA Change: E238D

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
Pfam:A_deaminase 309 716 7.6e-129 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176487
Predicted Effect probably benign
Transcript: ENSMUST00000213373
AA Change: E247D

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the adenosine and AMP deaminases family. The encoded protein is an AMP deaminase involved in nucleotide and energy metabolism in erythrocytes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased mean corpuscular volume, abnormal erythrocyte physiology including increased erythrocyte ATP levels and osmotic fragility after fasting, and increased lung inflammation after hind-limb ischemia andreperfusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrb1 T C 15: 74,540,459 F429S probably damaging Het
Ahi1 A T 10: 20,959,926 M53L possibly damaging Het
Ahr A T 12: 35,504,921 F400I probably damaging Het
Ak7 G T 12: 105,733,491 G223V possibly damaging Het
Alpk3 A G 7: 81,076,950 I128V possibly damaging Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Arhgef10l A G 4: 140,577,080 F243L probably damaging Het
Cdh23 A T 10: 60,433,758 V661E probably damaging Het
Cox8c A G 12: 102,900,275 T53A probably benign Het
Creld2 C A 15: 88,823,766 T236K possibly damaging Het
Cul3 A T 1: 80,283,759 C250S probably benign Het
Dhx37 A C 5: 125,424,666 F510V probably benign Het
Fblim1 T C 4: 141,577,909 D350G probably damaging Het
Lipm A G 19: 34,112,974 Y185C probably damaging Het
Mfsd4b4 A G 10: 39,892,053 F348S probably benign Het
Misp A G 10: 79,826,312 R188G possibly damaging Het
Nbeal1 T G 1: 60,248,405 I936S probably benign Het
Ngly1 G A 14: 16,294,634 M521I probably benign Het
Nlrp9a A T 7: 26,558,085 Y376F probably benign Het
Oas3 T C 5: 120,772,924 K197R probably damaging Het
Pars2 T C 4: 106,654,079 Y353H probably damaging Het
Pik3r1 T C 13: 101,686,320 N625D possibly damaging Het
Pkhd1l1 T A 15: 44,528,129 S1530R probably damaging Het
Rsph6a C T 7: 19,065,815 P457L probably damaging Het
Secisbp2 T C 13: 51,677,222 S565P probably benign Het
Slc28a3 T C 13: 58,578,487 M163V probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Szt2 T C 4: 118,371,974 T2890A unknown Het
Tatdn3 A T 1: 191,046,268 V242E probably benign Het
Vmn1r22 T G 6: 57,900,879 M38L probably benign Het
Vmn2r104 A G 17: 20,038,311 F524L possibly damaging Het
Vmn2r94 A G 17: 18,257,433 S239P probably damaging Het
Xpo7 T C 14: 70,682,338 D679G probably null Het
Zbtb42 C A 12: 112,679,607 T72K probably damaging Het
Zfp493 G A 13: 67,786,950 A341T possibly damaging Het
Zfp811 A G 17: 32,798,827 C80R possibly damaging Het
Other mutations in Ampd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Ampd3 APN 7 110803147 missense probably benign 0.01
IGL00576:Ampd3 APN 7 110788821 splice site probably benign
IGL00805:Ampd3 APN 7 110809865 missense possibly damaging 0.78
IGL01486:Ampd3 APN 7 110809916 splice site probably benign
IGL01551:Ampd3 APN 7 110804976 missense probably damaging 1.00
IGL02088:Ampd3 APN 7 110793686 missense probably benign 0.00
IGL02123:Ampd3 APN 7 110802559 missense possibly damaging 0.91
IGL02605:Ampd3 APN 7 110795758 missense probably benign 0.00
IGL02990:Ampd3 APN 7 110807963 splice site probably benign
carson UTSW 7 110800710 missense probably damaging 1.00
commanche UTSW 7 110807871 missense possibly damaging 0.95
guangdong UTSW 7 110803162 missense probably damaging 1.00
penasco UTSW 7 110803226 missense probably damaging 1.00
taos UTSW 7 110804935 missense probably damaging 0.99
R0025:Ampd3 UTSW 7 110793669 missense probably benign 0.04
R0025:Ampd3 UTSW 7 110793669 missense probably benign 0.04
R0608:Ampd3 UTSW 7 110795790 missense probably damaging 1.00
R0608:Ampd3 UTSW 7 110795791 missense probably damaging 1.00
R0718:Ampd3 UTSW 7 110777808 missense probably damaging 1.00
R0799:Ampd3 UTSW 7 110800697 missense probably damaging 1.00
R1053:Ampd3 UTSW 7 110788680 missense probably damaging 1.00
R1473:Ampd3 UTSW 7 110804935 missense probably damaging 0.99
R1676:Ampd3 UTSW 7 110795733 missense probably damaging 1.00
R1977:Ampd3 UTSW 7 110803162 missense probably damaging 1.00
R2380:Ampd3 UTSW 7 110800710 missense probably damaging 1.00
R2419:Ampd3 UTSW 7 110768369 unclassified probably benign
R3438:Ampd3 UTSW 7 110803226 missense probably damaging 1.00
R3907:Ampd3 UTSW 7 110793670 missense possibly damaging 0.88
R5367:Ampd3 UTSW 7 110807871 missense possibly damaging 0.95
R5625:Ampd3 UTSW 7 110802523 missense probably damaging 0.97
R6267:Ampd3 UTSW 7 110791180 splice site probably null
R6493:Ampd3 UTSW 7 110795811 splice site probably null
R6852:Ampd3 UTSW 7 110802546 missense probably benign 0.02
R7147:Ampd3 UTSW 7 110804852 missense probably damaging 1.00
R7313:Ampd3 UTSW 7 110806054 missense probably damaging 1.00
R7649:Ampd3 UTSW 7 110777842 missense probably benign 0.01
R7843:Ampd3 UTSW 7 110791188 missense probably benign 0.01
R7926:Ampd3 UTSW 7 110791188 missense probably benign 0.01
Z1088:Ampd3 UTSW 7 110777825 missense probably damaging 1.00
Z1177:Ampd3 UTSW 7 110788780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTGTCAAAGTGTTCAACATTGG -3'
(R):5'- TTCCACGTGCCCATGTACAG -3'

Sequencing Primer
(F):5'- GTTCAACATTGGTCATTTGGCC -3'
(R):5'- GCAGTAACAGCTCTAAGTCTGTGC -3'
Posted On2017-07-14