Incidental Mutation 'R6066:Misp'
ID484046
Institutional Source Beutler Lab
Gene Symbol Misp
Ensembl Gene ENSMUSG00000035852
Gene Namemitotic spindle positioning
Synonyms9130017N09Rik
MMRRC Submission 044230-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R6066 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location79820989-79830490 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79826312 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 188 (R188G)
Ref Sequence ENSEMBL: ENSMUSP00000151945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046833] [ENSMUST00000169041] [ENSMUST00000218687] [ENSMUST00000219305] [ENSMUST00000219734]
Predicted Effect probably benign
Transcript: ENSMUST00000046833
AA Change: R188G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000048893
Gene: ENSMUSG00000035852
AA Change: R188G

DomainStartEndE-ValueType
low complexity region 262 284 N/A INTRINSIC
Pfam:AKAP2_C 294 643 2.2e-140 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000169041
AA Change: R188G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000130071
Gene: ENSMUSG00000035852
AA Change: R188G

DomainStartEndE-ValueType
low complexity region 262 284 N/A INTRINSIC
Pfam:AKAP2_C 294 643 1.7e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218531
Predicted Effect possibly damaging
Transcript: ENSMUST00000218687
AA Change: R188G

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000219305
AA Change: R188G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000219734
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an actin-bundling protein involved in determining cell morphology and mitotic progression. The encoded protein is required for the proper positioning of the mitotic spindle. Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrb1 T C 15: 74,540,459 F429S probably damaging Het
Ahi1 A T 10: 20,959,926 M53L possibly damaging Het
Ahr A T 12: 35,504,921 F400I probably damaging Het
Ak7 G T 12: 105,733,491 G223V possibly damaging Het
Alpk3 A G 7: 81,076,950 I128V possibly damaging Het
Ampd3 A T 7: 110,793,767 E247D probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Arhgef10l A G 4: 140,577,080 F243L probably damaging Het
Cdh23 A T 10: 60,433,758 V661E probably damaging Het
Cox8c A G 12: 102,900,275 T53A probably benign Het
Creld2 C A 15: 88,823,766 T236K possibly damaging Het
Cul3 A T 1: 80,283,759 C250S probably benign Het
Dhx37 A C 5: 125,424,666 F510V probably benign Het
Fblim1 T C 4: 141,577,909 D350G probably damaging Het
Lipm A G 19: 34,112,974 Y185C probably damaging Het
Mfsd4b4 A G 10: 39,892,053 F348S probably benign Het
Nbeal1 T G 1: 60,248,405 I936S probably benign Het
Ngly1 G A 14: 16,294,634 M521I probably benign Het
Nlrp9a A T 7: 26,558,085 Y376F probably benign Het
Oas3 T C 5: 120,772,924 K197R probably damaging Het
Pars2 T C 4: 106,654,079 Y353H probably damaging Het
Pik3r1 T C 13: 101,686,320 N625D possibly damaging Het
Pkhd1l1 T A 15: 44,528,129 S1530R probably damaging Het
Rsph6a C T 7: 19,065,815 P457L probably damaging Het
Secisbp2 T C 13: 51,677,222 S565P probably benign Het
Slc28a3 T C 13: 58,578,487 M163V probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Szt2 T C 4: 118,371,974 T2890A unknown Het
Tatdn3 A T 1: 191,046,268 V242E probably benign Het
Vmn1r22 T G 6: 57,900,879 M38L probably benign Het
Vmn2r104 A G 17: 20,038,311 F524L possibly damaging Het
Vmn2r94 A G 17: 18,257,433 S239P probably damaging Het
Xpo7 T C 14: 70,682,338 D679G probably null Het
Zbtb42 C A 12: 112,679,607 T72K probably damaging Het
Zfp493 G A 13: 67,786,950 A341T possibly damaging Het
Zfp811 A G 17: 32,798,827 C80R possibly damaging Het
Other mutations in Misp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02419:Misp APN 10 79827871 unclassified probably benign
IGL02565:Misp APN 10 79826343 missense probably benign 0.33
IGL02901:Misp APN 10 79826937 missense possibly damaging 0.70
R1118:Misp UTSW 10 79827135 missense probably benign 0.01
R1421:Misp UTSW 10 79826847 missense probably damaging 1.00
R1656:Misp UTSW 10 79825943 missense possibly damaging 0.75
R2864:Misp UTSW 10 79827038 missense probably benign 0.05
R3786:Misp UTSW 10 79825961 missense probably benign 0.23
R5035:Misp UTSW 10 79827956 missense probably benign 0.01
R5503:Misp UTSW 10 79826718 missense probably damaging 1.00
R5594:Misp UTSW 10 79827143 missense probably damaging 1.00
R5982:Misp UTSW 10 79827894 nonsense probably null
R6236:Misp UTSW 10 79827122 missense probably benign 0.00
R7103:Misp UTSW 10 79827165 missense probably damaging 1.00
R8170:Misp UTSW 10 79826466 missense probably benign 0.39
R8479:Misp UTSW 10 79827916 missense possibly damaging 0.91
R8961:Misp UTSW 10 79827989 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TATCACCTGGACGACAGCAG -3'
(R):5'- GACTGCCAGGATCATTGACTATATGG -3'

Sequencing Primer
(F):5'- GACAGCAGTGACACCCTCTG -3'
(R):5'- TCATTGACTATATGGATGGATCTAGC -3'
Posted On2017-07-14