Incidental Mutation 'R6066:Arhgap44'
ID484048
Institutional Source Beutler Lab
Gene Symbol Arhgap44
Ensembl Gene ENSMUSG00000033389
Gene NameRho GTPase activating protein 44
SynonymsAU040829
MMRRC Submission 044230-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6066 (G1)
Quality Score217.468
Status Not validated
Chromosome11
Chromosomal Location65002039-65162961 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CTGCT to CTGCTTGCT at 65032084 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000047463] [ENSMUST00000093002]
Predicted Effect probably null
Transcript: ENSMUST00000047463
SMART Domains Protein: ENSMUSP00000039139
Gene: ENSMUSG00000033389

DomainStartEndE-ValueType
BAR 1 242 2.27e-71 SMART
RhoGAP 266 442 1.07e-66 SMART
low complexity region 530 556 N/A INTRINSIC
low complexity region 561 575 N/A INTRINSIC
low complexity region 592 606 N/A INTRINSIC
low complexity region 616 631 N/A INTRINSIC
low complexity region 664 689 N/A INTRINSIC
low complexity region 695 707 N/A INTRINSIC
low complexity region 716 746 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000093002
SMART Domains Protein: ENSMUSP00000090681
Gene: ENSMUSG00000033389

DomainStartEndE-ValueType
BAR 1 242 2.27e-71 SMART
RhoGAP 266 442 1.07e-66 SMART
low complexity region 536 562 N/A INTRINSIC
low complexity region 567 581 N/A INTRINSIC
low complexity region 598 612 N/A INTRINSIC
low complexity region 622 637 N/A INTRINSIC
low complexity region 670 695 N/A INTRINSIC
low complexity region 701 713 N/A INTRINSIC
low complexity region 722 752 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119723
Predicted Effect probably null
Transcript: ENSMUST00000130420
SMART Domains Protein: ENSMUSP00000115612
Gene: ENSMUSG00000033389

DomainStartEndE-ValueType
Pfam:BAR 1 117 1.1e-29 PFAM
RhoGAP 141 317 1.07e-66 SMART
low complexity region 411 437 N/A INTRINSIC
low complexity region 442 456 N/A INTRINSIC
low complexity region 473 487 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
low complexity region 545 570 N/A INTRINSIC
low complexity region 576 588 N/A INTRINSIC
low complexity region 597 627 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrb1 T C 15: 74,540,459 F429S probably damaging Het
Ahi1 A T 10: 20,959,926 M53L possibly damaging Het
Ahr A T 12: 35,504,921 F400I probably damaging Het
Ak7 G T 12: 105,733,491 G223V possibly damaging Het
Alpk3 A G 7: 81,076,950 I128V possibly damaging Het
Ampd3 A T 7: 110,793,767 E247D probably benign Het
Arhgef10l A G 4: 140,577,080 F243L probably damaging Het
Cdh23 A T 10: 60,433,758 V661E probably damaging Het
Cox8c A G 12: 102,900,275 T53A probably benign Het
Creld2 C A 15: 88,823,766 T236K possibly damaging Het
Cul3 A T 1: 80,283,759 C250S probably benign Het
Dhx37 A C 5: 125,424,666 F510V probably benign Het
Fblim1 T C 4: 141,577,909 D350G probably damaging Het
Lipm A G 19: 34,112,974 Y185C probably damaging Het
Mfsd4b4 A G 10: 39,892,053 F348S probably benign Het
Misp A G 10: 79,826,312 R188G possibly damaging Het
Nbeal1 T G 1: 60,248,405 I936S probably benign Het
Ngly1 G A 14: 16,294,634 M521I probably benign Het
Nlrp9a A T 7: 26,558,085 Y376F probably benign Het
Oas3 T C 5: 120,772,924 K197R probably damaging Het
Pars2 T C 4: 106,654,079 Y353H probably damaging Het
Pik3r1 T C 13: 101,686,320 N625D possibly damaging Het
Pkhd1l1 T A 15: 44,528,129 S1530R probably damaging Het
Rsph6a C T 7: 19,065,815 P457L probably damaging Het
Secisbp2 T C 13: 51,677,222 S565P probably benign Het
Slc28a3 T C 13: 58,578,487 M163V probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Szt2 T C 4: 118,371,974 T2890A unknown Het
Tatdn3 A T 1: 191,046,268 V242E probably benign Het
Vmn1r22 T G 6: 57,900,879 M38L probably benign Het
Vmn2r104 A G 17: 20,038,311 F524L possibly damaging Het
Vmn2r94 A G 17: 18,257,433 S239P probably damaging Het
Xpo7 T C 14: 70,682,338 D679G probably null Het
Zbtb42 C A 12: 112,679,607 T72K probably damaging Het
Zfp493 G A 13: 67,786,950 A341T possibly damaging Het
Zfp811 A G 17: 32,798,827 C80R possibly damaging Het
Other mutations in Arhgap44
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Arhgap44 APN 11 65041449 missense probably damaging 0.96
IGL01553:Arhgap44 APN 11 65053118 missense probably damaging 1.00
IGL01868:Arhgap44 APN 11 65012078 missense probably damaging 1.00
IGL01996:Arhgap44 APN 11 65005496 utr 3 prime probably benign
IGL02093:Arhgap44 APN 11 65074534 missense probably damaging 1.00
IGL02962:Arhgap44 APN 11 65067161 splice site probably benign
IGL02963:Arhgap44 APN 11 65031663 missense probably damaging 1.00
IGL03032:Arhgap44 APN 11 65024212 missense probably damaging 1.00
R0071:Arhgap44 UTSW 11 65011895 missense possibly damaging 0.90
R0152:Arhgap44 UTSW 11 65011919 missense probably benign 0.13
R0402:Arhgap44 UTSW 11 65032077 splice site probably benign
R1109:Arhgap44 UTSW 11 65026816 missense probably benign 0.00
R1694:Arhgap44 UTSW 11 65053197 missense probably damaging 1.00
R1946:Arhgap44 UTSW 11 65012096 missense probably damaging 0.99
R2036:Arhgap44 UTSW 11 65041492 missense possibly damaging 0.83
R2356:Arhgap44 UTSW 11 65010025 missense probably damaging 1.00
R4342:Arhgap44 UTSW 11 65012061 nonsense probably null
R4657:Arhgap44 UTSW 11 65005452 critical splice donor site probably null
R4763:Arhgap44 UTSW 11 65039165 missense probably damaging 0.98
R4803:Arhgap44 UTSW 11 65053095 missense probably benign 0.00
R5652:Arhgap44 UTSW 11 65024238 missense probably damaging 1.00
R5663:Arhgap44 UTSW 11 65024291 missense probably damaging 1.00
R5833:Arhgap44 UTSW 11 65038677 missense probably damaging 1.00
R6000:Arhgap44 UTSW 11 65032084 frame shift probably null
R6001:Arhgap44 UTSW 11 65032084 frame shift probably null
R6046:Arhgap44 UTSW 11 65032084 frame shift probably null
R6160:Arhgap44 UTSW 11 65162549 unclassified probably benign
R6661:Arhgap44 UTSW 11 65010008 missense probably damaging 0.97
R7062:Arhgap44 UTSW 11 65011932 missense probably benign 0.25
R7388:Arhgap44 UTSW 11 65024268 nonsense probably null
R7793:Arhgap44 UTSW 11 65009924 missense probably damaging 0.99
X0022:Arhgap44 UTSW 11 65053212 missense probably damaging 1.00
X0061:Arhgap44 UTSW 11 65038645 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCACATCACCTTGCCATTGG -3'
(R):5'- ACGGCATTAGTGAAGTCCTGG -3'

Sequencing Primer
(F):5'- GCCATTGGCTAGCTGTACAG -3'
(R):5'- AGGAGCAGGTAGACTTCCTATTC -3'
Posted On2017-07-14