Incidental Mutation 'R6066:Zbtb42'
ID484052
Institutional Source Beutler Lab
Gene Symbol Zbtb42
Ensembl Gene ENSMUSG00000037638
Gene Namezinc finger and BTB domain containing 42
SynonymsGm5188, simiRP58
MMRRC Submission 044230-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6066 (G1)
Quality Score156.008
Status Not validated
Chromosome12
Chromosomal Location112678828-112682747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 112679607 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 72 (T72K)
Ref Sequence ENSEMBL: ENSMUSP00000133152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000144550] [ENSMUST00000169593] [ENSMUST00000173942] [ENSMUST00000174780]
Predicted Effect probably benign
Transcript: ENSMUST00000144550
SMART Domains Protein: ENSMUSP00000123689
Gene: ENSMUSG00000001729

DomainStartEndE-ValueType
PH 6 110 2.41e-16 SMART
Pfam:Pkinase 150 202 2.6e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000169593
AA Change: T72K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133152
Gene: ENSMUSG00000037638
AA Change: T72K

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
BTB 24 122 8.88e-22 SMART
low complexity region 226 241 N/A INTRINSIC
ZnF_C2H2 292 314 3.02e0 SMART
ZnF_C2H2 332 354 2.02e-1 SMART
ZnF_C2H2 360 382 5.06e-2 SMART
ZnF_C2H2 388 411 2.71e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173942
SMART Domains Protein: ENSMUSP00000133987
Gene: ENSMUSG00000037638

DomainStartEndE-ValueType
Blast:BTB 1 40 8e-22 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174780
SMART Domains Protein: ENSMUSP00000134028
Gene: ENSMUSG00000037638

DomainStartEndE-ValueType
Pfam:BTB 1 40 1.3e-5 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the C2H2 zinc finger protein family. This protein is predicted to have a pox virus and zinc finger (POZ) domain at the N-terminus and four zinc finger domains at the C-terminus. In human and mouse, the protein localizes to the nuclei of skeletal muscle cells. Knockdown of this gene in zebrafish results in abnormal skeletal muscle development and myofibrillar disorganization. A novel homozygous variant of the human gene has been associated with lethal congenital contracture syndrome, an autosomal recessive disorder that results in muscle wasting. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrb1 T C 15: 74,540,459 F429S probably damaging Het
Ahi1 A T 10: 20,959,926 M53L possibly damaging Het
Ahr A T 12: 35,504,921 F400I probably damaging Het
Ak7 G T 12: 105,733,491 G223V possibly damaging Het
Alpk3 A G 7: 81,076,950 I128V possibly damaging Het
Ampd3 A T 7: 110,793,767 E247D probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Arhgef10l A G 4: 140,577,080 F243L probably damaging Het
Cdh23 A T 10: 60,433,758 V661E probably damaging Het
Cox8c A G 12: 102,900,275 T53A probably benign Het
Creld2 C A 15: 88,823,766 T236K possibly damaging Het
Cul3 A T 1: 80,283,759 C250S probably benign Het
Dhx37 A C 5: 125,424,666 F510V probably benign Het
Fblim1 T C 4: 141,577,909 D350G probably damaging Het
Lipm A G 19: 34,112,974 Y185C probably damaging Het
Mfsd4b4 A G 10: 39,892,053 F348S probably benign Het
Misp A G 10: 79,826,312 R188G possibly damaging Het
Nbeal1 T G 1: 60,248,405 I936S probably benign Het
Ngly1 G A 14: 16,294,634 M521I probably benign Het
Nlrp9a A T 7: 26,558,085 Y376F probably benign Het
Oas3 T C 5: 120,772,924 K197R probably damaging Het
Pars2 T C 4: 106,654,079 Y353H probably damaging Het
Pik3r1 T C 13: 101,686,320 N625D possibly damaging Het
Pkhd1l1 T A 15: 44,528,129 S1530R probably damaging Het
Rsph6a C T 7: 19,065,815 P457L probably damaging Het
Secisbp2 T C 13: 51,677,222 S565P probably benign Het
Slc28a3 T C 13: 58,578,487 M163V probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Szt2 T C 4: 118,371,974 T2890A unknown Het
Tatdn3 A T 1: 191,046,268 V242E probably benign Het
Vmn1r22 T G 6: 57,900,879 M38L probably benign Het
Vmn2r104 A G 17: 20,038,311 F524L possibly damaging Het
Vmn2r94 A G 17: 18,257,433 S239P probably damaging Het
Xpo7 T C 14: 70,682,338 D679G probably null Het
Zfp493 G A 13: 67,786,950 A341T possibly damaging Het
Zfp811 A G 17: 32,798,827 C80R possibly damaging Het
Other mutations in Zbtb42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01712:Zbtb42 APN 12 112680284 missense probably benign 0.35
R0607:Zbtb42 UTSW 12 112680627 missense probably benign 0.32
R4586:Zbtb42 UTSW 12 112680542 missense probably damaging 1.00
R4607:Zbtb42 UTSW 12 112680542 missense probably damaging 1.00
R4609:Zbtb42 UTSW 12 112680542 missense probably damaging 1.00
R4890:Zbtb42 UTSW 12 112680427 nonsense probably null
R5143:Zbtb42 UTSW 12 112679514 missense probably damaging 1.00
R5933:Zbtb42 UTSW 12 112680621 missense probably damaging 1.00
R6245:Zbtb42 UTSW 12 112679535 missense probably damaging 1.00
R6974:Zbtb42 UTSW 12 112680390 missense probably damaging 0.97
R8092:Zbtb42 UTSW 12 112679841 missense probably damaging 1.00
R8253:Zbtb42 UTSW 12 112680312 missense probably damaging 1.00
Z1176:Zbtb42 UTSW 12 112680199 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGTGCCCAGGTGATGACTG -3'
(R):5'- TAGCCTTGACCCCTAGAGATGG -3'

Sequencing Primer
(F):5'- ATGGAGTTCCCGGAGCAC -3'
(R):5'- AAGCTCTGTCCCCAGCGTAC -3'
Posted On2017-07-14