Incidental Mutation 'R6066:Slc28a3'
ID484054
Institutional Source Beutler Lab
Gene Symbol Slc28a3
Ensembl Gene ENSMUSG00000021553
Gene Namesolute carrier family 28 (sodium-coupled nucleoside transporter), member 3
SynonymsCnt3
MMRRC Submission 044230-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6066 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location58545399-58610877 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58578487 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 163 (M163V)
Ref Sequence ENSEMBL: ENSMUSP00000022036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022036] [ENSMUST00000148396]
Predicted Effect probably benign
Transcript: ENSMUST00000022036
AA Change: M163V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000022036
Gene: ENSMUSG00000021553
AA Change: M163V

DomainStartEndE-ValueType
transmembrane domain 119 141 N/A INTRINSIC
transmembrane domain 146 163 N/A INTRINSIC
transmembrane domain 184 206 N/A INTRINSIC
Pfam:Nucleos_tra2_N 221 292 3.5e-27 PFAM
Pfam:Gate 300 401 4.9e-11 PFAM
Pfam:Nucleos_tra2_C 403 627 4.1e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148396
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224906
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleoside transporters, such as SLC28A3, regulate multiple cellular processes, including neurotransmission, vascular tone, adenosine concentration in the vicinity of cell surface receptors, and transport and metabolism of nucleoside drugs. SLC28A3 shows broad specificity for pyrimidine and purine nucleosides (Ritzel et al., 2001 [PubMed 11032837]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adgrb1 T C 15: 74,540,459 F429S probably damaging Het
Ahi1 A T 10: 20,959,926 M53L possibly damaging Het
Ahr A T 12: 35,504,921 F400I probably damaging Het
Ak7 G T 12: 105,733,491 G223V possibly damaging Het
Alpk3 A G 7: 81,076,950 I128V possibly damaging Het
Ampd3 A T 7: 110,793,767 E247D probably benign Het
Arhgap44 CTGCT CTGCTTGCT 11: 65,032,084 probably null Het
Arhgef10l A G 4: 140,577,080 F243L probably damaging Het
Cdh23 A T 10: 60,433,758 V661E probably damaging Het
Cox8c A G 12: 102,900,275 T53A probably benign Het
Creld2 C A 15: 88,823,766 T236K possibly damaging Het
Cul3 A T 1: 80,283,759 C250S probably benign Het
Dhx37 A C 5: 125,424,666 F510V probably benign Het
Fblim1 T C 4: 141,577,909 D350G probably damaging Het
Lipm A G 19: 34,112,974 Y185C probably damaging Het
Mfsd4b4 A G 10: 39,892,053 F348S probably benign Het
Misp A G 10: 79,826,312 R188G possibly damaging Het
Nbeal1 T G 1: 60,248,405 I936S probably benign Het
Ngly1 G A 14: 16,294,634 M521I probably benign Het
Nlrp9a A T 7: 26,558,085 Y376F probably benign Het
Oas3 T C 5: 120,772,924 K197R probably damaging Het
Pars2 T C 4: 106,654,079 Y353H probably damaging Het
Pik3r1 T C 13: 101,686,320 N625D possibly damaging Het
Pkhd1l1 T A 15: 44,528,129 S1530R probably damaging Het
Rsph6a C T 7: 19,065,815 P457L probably damaging Het
Secisbp2 T C 13: 51,677,222 S565P probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Svil T G 18: 5,106,724 V1855G probably damaging Het
Szt2 T C 4: 118,371,974 T2890A unknown Het
Tatdn3 A T 1: 191,046,268 V242E probably benign Het
Vmn1r22 T G 6: 57,900,879 M38L probably benign Het
Vmn2r104 A G 17: 20,038,311 F524L possibly damaging Het
Vmn2r94 A G 17: 18,257,433 S239P probably damaging Het
Xpo7 T C 14: 70,682,338 D679G probably null Het
Zbtb42 C A 12: 112,679,607 T72K probably damaging Het
Zfp493 G A 13: 67,786,950 A341T possibly damaging Het
Zfp811 A G 17: 32,798,827 C80R possibly damaging Het
Other mutations in Slc28a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Slc28a3 APN 13 58574300 missense probably benign 0.05
IGL00432:Slc28a3 APN 13 58569411 splice site probably null
IGL00553:Slc28a3 APN 13 58563009 splice site probably null
IGL01725:Slc28a3 APN 13 58578510 missense probably benign 0.30
IGL02068:Slc28a3 APN 13 58558597 missense probably damaging 1.00
IGL02270:Slc28a3 APN 13 58580584 missense probably benign 0.00
IGL02271:Slc28a3 APN 13 58558637 missense probably benign 0.21
IGL02373:Slc28a3 APN 13 58578404 critical splice donor site probably null
IGL02542:Slc28a3 APN 13 58573470 missense probably damaging 1.00
IGL03242:Slc28a3 APN 13 58574249 nonsense probably null
R0256:Slc28a3 UTSW 13 58573500 missense probably benign
R0323:Slc28a3 UTSW 13 58564052 nonsense probably null
R0391:Slc28a3 UTSW 13 58569415 splice site probably benign
R0838:Slc28a3 UTSW 13 58588269 missense probably benign 0.00
R1433:Slc28a3 UTSW 13 58563106 missense probably damaging 1.00
R1437:Slc28a3 UTSW 13 58558575 nonsense probably null
R3499:Slc28a3 UTSW 13 58573439 splice site probably benign
R3822:Slc28a3 UTSW 13 58558278 missense probably benign 0.00
R3948:Slc28a3 UTSW 13 58563010 splice site probably null
R4011:Slc28a3 UTSW 13 58566250 missense probably benign 0.06
R4028:Slc28a3 UTSW 13 58610756 missense probably benign 0.27
R4073:Slc28a3 UTSW 13 58559290 missense probably benign 0.01
R4745:Slc28a3 UTSW 13 58574263 missense possibly damaging 0.69
R4939:Slc28a3 UTSW 13 58558581 missense probably benign 0.44
R5416:Slc28a3 UTSW 13 58576793 missense probably damaging 0.99
R5421:Slc28a3 UTSW 13 58574265 missense possibly damaging 0.87
R5426:Slc28a3 UTSW 13 58563154 missense probably damaging 1.00
R5688:Slc28a3 UTSW 13 58558649 missense probably damaging 0.96
R6790:Slc28a3 UTSW 13 58582650 missense probably benign 0.00
R6919:Slc28a3 UTSW 13 58573443 critical splice donor site probably null
R7009:Slc28a3 UTSW 13 58610804 missense probably benign 0.28
R7102:Slc28a3 UTSW 13 58588214 missense probably benign 0.04
R7305:Slc28a3 UTSW 13 58566231 missense possibly damaging 0.65
R7307:Slc28a3 UTSW 13 58563172 missense probably damaging 1.00
R7464:Slc28a3 UTSW 13 58563021 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCAGCACCTCAGATAAGGG -3'
(R):5'- CCATCGTGGTGAAATCTTAGGG -3'

Sequencing Primer
(F):5'- CACCTCAGATAAGGGGCTTCTTG -3'
(R):5'- CATCGTGGTGAAATCTTAGGGACTTC -3'
Posted On2017-07-14